ID: 1067576311

View in Genome Browser
Species Human (GRCh38)
Location 10:47410821-47410843
Sequence ATGTGGCTCAGTAGTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067576302_1067576311 8 Left 1067576302 10:47410790-47410812 CCCCAGAAAATCCCCTCAGACCT No data
Right 1067576311 10:47410821-47410843 ATGTGGCTCAGTAGTTCCCTGGG No data
1067576303_1067576311 7 Left 1067576303 10:47410791-47410813 CCCAGAAAATCCCCTCAGACCTC No data
Right 1067576311 10:47410821-47410843 ATGTGGCTCAGTAGTTCCCTGGG No data
1067576301_1067576311 9 Left 1067576301 10:47410789-47410811 CCCCCAGAAAATCCCCTCAGACC No data
Right 1067576311 10:47410821-47410843 ATGTGGCTCAGTAGTTCCCTGGG No data
1067576307_1067576311 -5 Left 1067576307 10:47410803-47410825 CCTCAGACCTCTCTGTGCATGTG No data
Right 1067576311 10:47410821-47410843 ATGTGGCTCAGTAGTTCCCTGGG No data
1067576306_1067576311 -4 Left 1067576306 10:47410802-47410824 CCCTCAGACCTCTCTGTGCATGT No data
Right 1067576311 10:47410821-47410843 ATGTGGCTCAGTAGTTCCCTGGG No data
1067576304_1067576311 6 Left 1067576304 10:47410792-47410814 CCAGAAAATCCCCTCAGACCTCT No data
Right 1067576311 10:47410821-47410843 ATGTGGCTCAGTAGTTCCCTGGG No data
1067576305_1067576311 -3 Left 1067576305 10:47410801-47410823 CCCCTCAGACCTCTCTGTGCATG No data
Right 1067576311 10:47410821-47410843 ATGTGGCTCAGTAGTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067576311 Original CRISPR ATGTGGCTCAGTAGTTCCCT GGG Intergenic
No off target data available for this crispr