ID: 1067578087

View in Genome Browser
Species Human (GRCh38)
Location 10:47420340-47420362
Sequence GATGCAGATGTGGCTCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067578081_1067578087 -7 Left 1067578081 10:47420324-47420346 CCGTCCCCAGGCTCCGGATGCAG No data
Right 1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG No data
1067578074_1067578087 15 Left 1067578074 10:47420302-47420324 CCCGTGTTTTAGGGACCTGGCCC No data
Right 1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG No data
1067578075_1067578087 14 Left 1067578075 10:47420303-47420325 CCGTGTTTTAGGGACCTGGCCCC No data
Right 1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG No data
1067578073_1067578087 16 Left 1067578073 10:47420301-47420323 CCCCGTGTTTTAGGGACCTGGCC No data
Right 1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG No data
1067578079_1067578087 -5 Left 1067578079 10:47420322-47420344 CCCCGTCCCCAGGCTCCGGATGC No data
Right 1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG No data
1067578077_1067578087 0 Left 1067578077 10:47420317-47420339 CCTGGCCCCGTCCCCAGGCTCCG No data
Right 1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG No data
1067578080_1067578087 -6 Left 1067578080 10:47420323-47420345 CCCGTCCCCAGGCTCCGGATGCA No data
Right 1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067578087 Original CRISPR GATGCAGATGTGGCTCCATT TGG Intergenic
No off target data available for this crispr