ID: 1067582183

View in Genome Browser
Species Human (GRCh38)
Location 10:47452765-47452787
Sequence GTCTCCCTCCCCCACCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067582172_1067582183 25 Left 1067582172 10:47452717-47452739 CCAACTTCCCTGCGCTAAAGCCT No data
Right 1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG No data
1067582176_1067582183 5 Left 1067582176 10:47452737-47452759 CCTCAGCACTCCCCGTGGCTTTG No data
Right 1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG No data
1067582171_1067582183 28 Left 1067582171 10:47452714-47452736 CCACCAACTTCCCTGCGCTAAAG No data
Right 1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG No data
1067582170_1067582183 29 Left 1067582170 10:47452713-47452735 CCCACCAACTTCCCTGCGCTAAA No data
Right 1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG No data
1067582179_1067582183 -7 Left 1067582179 10:47452749-47452771 CCGTGGCTTTGACCCTGTCTCCC No data
Right 1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG No data
1067582174_1067582183 17 Left 1067582174 10:47452725-47452747 CCTGCGCTAAAGCCTCAGCACTC No data
Right 1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG No data
1067582173_1067582183 18 Left 1067582173 10:47452724-47452746 CCCTGCGCTAAAGCCTCAGCACT No data
Right 1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG No data
1067582177_1067582183 -5 Left 1067582177 10:47452747-47452769 CCCCGTGGCTTTGACCCTGTCTC No data
Right 1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG No data
1067582178_1067582183 -6 Left 1067582178 10:47452748-47452770 CCCGTGGCTTTGACCCTGTCTCC No data
Right 1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067582183 Original CRISPR GTCTCCCTCCCCCACCGGCC AGG Intergenic
No off target data available for this crispr