ID: 1067582201

View in Genome Browser
Species Human (GRCh38)
Location 10:47452854-47452876
Sequence CCTTGGGTGCAGGGGCTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067582201_1067582226 29 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582226 10:47452906-47452928 GGCAGGGCAGAGGGAGGGCAGGG No data
1067582201_1067582222 20 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582222 10:47452897-47452919 AGGGAAGGAGGCAGGGCAGAGGG No data
1067582201_1067582214 8 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582214 10:47452885-47452907 CAGCCACCTCCCAGGGAAGGAGG No data
1067582201_1067582227 30 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582227 10:47452907-47452929 GCAGGGCAGAGGGAGGGCAGGGG No data
1067582201_1067582210 0 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582210 10:47452877-47452899 AATCCTCACAGCCACCTCCCAGG No data
1067582201_1067582223 23 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582223 10:47452900-47452922 GAAGGAGGCAGGGCAGAGGGAGG No data
1067582201_1067582225 28 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582225 10:47452905-47452927 AGGCAGGGCAGAGGGAGGGCAGG No data
1067582201_1067582216 12 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582216 10:47452889-47452911 CACCTCCCAGGGAAGGAGGCAGG No data
1067582201_1067582213 5 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582213 10:47452882-47452904 TCACAGCCACCTCCCAGGGAAGG No data
1067582201_1067582221 19 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582221 10:47452896-47452918 CAGGGAAGGAGGCAGGGCAGAGG No data
1067582201_1067582224 24 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582224 10:47452901-47452923 AAGGAGGCAGGGCAGAGGGAGGG No data
1067582201_1067582211 1 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582211 10:47452878-47452900 ATCCTCACAGCCACCTCCCAGGG No data
1067582201_1067582217 13 Left 1067582201 10:47452854-47452876 CCCGCCAGCCCCTGCACCCAAGG No data
Right 1067582217 10:47452890-47452912 ACCTCCCAGGGAAGGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067582201 Original CRISPR CCTTGGGTGCAGGGGCTGGC GGG (reversed) Intergenic
No off target data available for this crispr