ID: 1067584942

View in Genome Browser
Species Human (GRCh38)
Location 10:47470150-47470172
Sequence TTGCCTCTTAATTTCAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067584942 Original CRISPR TTGCCTCTTAATTTCAATGC AGG Intronic
903099878 1:21019986-21020008 TTGGCTCTTCATGTCAATGAGGG + Intronic
903521561 1:23954661-23954683 TTTCCTCTTCCTATCAATGCAGG + Intergenic
903863638 1:26381475-26381497 TTACCTCTTAATTTCTAATCTGG - Intergenic
906141923 1:43539051-43539073 TTGCCACTTTATTTCACAGCAGG - Intronic
918480762 1:184974440-184974462 TTTGCTCTTAATTTCAGAGCCGG - Exonic
918570653 1:185987931-185987953 TTCCCTCTTAATTTCAGCGCAGG - Intronic
918872606 1:189995220-189995242 TTGCCACTTAACTTCTATTCAGG - Intergenic
920667782 1:207978027-207978049 TTGGCACTCAATTTCAATGCTGG - Intergenic
922702288 1:227768971-227768993 TTACCTGTTAATTGCAATGGTGG + Intronic
923317119 1:232791727-232791749 TTAACTAATAATTTCAATGCTGG - Intergenic
1063068268 10:2632212-2632234 CTGCCTTTTAATTTCAACTCTGG + Intergenic
1067452295 10:46389606-46389628 TTGCCTCTTAATTTCAATGCAGG - Intronic
1067584942 10:47470150-47470172 TTGCCTCTTAATTTCAATGCAGG + Intronic
1069107228 10:64397740-64397762 TTGCCTCTTAATGTGCGTGCTGG + Intergenic
1071043578 10:81344232-81344254 TGGGCTCTGAATTTAAATGCTGG - Intergenic
1072284652 10:93902108-93902130 GTGCCTTTTCATTTTAATGCTGG + Exonic
1073555108 10:104442183-104442205 TTGCCTTTTTTTTTCAATTCTGG + Intronic
1074340967 10:112629462-112629484 TTTCTTCTTAATTCCAATGTGGG - Intronic
1078209830 11:9261835-9261857 TTCCCTCTTCATTTCATTTCTGG - Intronic
1081579197 11:44340384-44340406 TTGCCACTGAATTTAACTGCTGG - Intergenic
1083108793 11:60385105-60385127 TTGCCTGTTGATTTCAAGTCTGG + Exonic
1085684201 11:78606754-78606776 TTCCCTCTTTATTCCATTGCAGG + Intergenic
1087213819 11:95472659-95472681 TTGCCTCTTAATTTCTATAATGG + Intergenic
1090403190 11:126461900-126461922 TGGGCTCTGAATTTCAAGGCTGG - Intronic
1090530069 11:127581690-127581712 TTGGCTCTCATTTTCAAGGCTGG + Intergenic
1090648048 11:128781947-128781969 TTGCCTCTCAGGTTCACTGCTGG + Exonic
1093728208 12:22540099-22540121 TTGCCTCTTGATTTACATGATGG - Intronic
1093961514 12:25278124-25278146 TTGCATGGTAATTTCACTGCTGG - Intergenic
1095470122 12:42527480-42527502 TTGCATCTTGACTTCCATGCTGG - Intronic
1099375424 12:81892310-81892332 TTTCCTATTAATTTCACTTCTGG - Intergenic
1099440585 12:82694518-82694540 TTGTTTCTTAATTTCTTTGCCGG + Intronic
1101044075 12:100786558-100786580 TTCCCTCCAAATTTGAATGCTGG + Intronic
1101771551 12:107756404-107756426 TTGCCATTTAATTTCAAACCTGG + Intronic
1102905273 12:116669851-116669873 TTGCCTCTTAATGCACATGCTGG + Intergenic
1103892181 12:124248094-124248116 TTTCCTATTATTTTTAATGCTGG + Intronic
1104088706 12:125496408-125496430 TTGCCTCATAATTTCAACTGTGG - Intronic
1106738664 13:32615034-32615056 TTGTCTCTTGATCTGAATGCTGG - Intronic
1107602652 13:42029260-42029282 TTGCCTCTCATTATTAATGCAGG - Intergenic
1110333329 13:74297667-74297689 TTGCCTCTTTATTTCTAGGTAGG - Intergenic
1110993399 13:82072476-82072498 CTGCCTCTTACTGTGAATGCTGG - Intergenic
1114311956 14:21476093-21476115 TTGCCTATTAATTCTAAGGCAGG + Intronic
1114387386 14:22269246-22269268 TTGTCTCTTAATGTACATGCTGG - Intergenic
1116692879 14:48133154-48133176 TTGCCTCTTCATGTCTATGTGGG - Intergenic
1117232486 14:53735407-53735429 TTACTTCTTAATGTCAAAGCAGG + Intergenic
1118433874 14:65751414-65751436 TTGCATCTGAATTTCACTCCAGG + Intergenic
1120240514 14:81944398-81944420 TTAGCTGTTAATTTCAAGGCTGG - Intergenic
1120356917 14:83445715-83445737 TTGGAGCTTAACTTCAATGCAGG - Intergenic
1120359797 14:83484780-83484802 TTGAATCTTAATCCCAATGCTGG + Intergenic
1121553050 14:94816667-94816689 TTTGCTCTTGATTTCAGTGCTGG + Intergenic
1125267747 15:37902724-37902746 TGGCCAAGTAATTTCAATGCTGG + Intergenic
1125842121 15:42812961-42812983 CTGCCTCTTAAGTTCACTACTGG - Intronic
1127128372 15:55835913-55835935 TTTTCTCTGAATTTCAATGAGGG - Intronic
1129408406 15:75335320-75335342 TTGCCTCTTCAAGTCAATGTCGG + Intergenic
1129471499 15:75757839-75757861 TTGCCTCTTCAAGTCAATGTCGG + Intergenic
1130433702 15:83874838-83874860 GTGCCTTTTACTTTCAGTGCAGG - Intronic
1132166912 15:99602454-99602476 TTGCCTCTTAATGCGCATGCTGG + Intronic
1132275688 15:100561566-100561588 TCCCCTCTTAATTGCAAAGCTGG - Intronic
1133629224 16:7603382-7603404 TTGACTGTTAATTTTAATGAGGG + Intronic
1139794671 16:69472778-69472800 TTGCATCTTAAATCCAATGCTGG + Intergenic
1141409974 16:83826442-83826464 CTGCCTCTTTATTTGCATGCAGG - Intergenic
1142857946 17:2743095-2743117 TTGCCCCTTGTTTTCCATGCAGG + Intergenic
1144499897 17:15777215-15777237 TTGCCTTTTAAGTTGAATGAGGG + Intergenic
1149584805 17:57778950-57778972 TGGCCTCATAATTTCACTTCTGG + Intergenic
1150324284 17:64243661-64243683 TTGCATCTTATTTTAAATGAAGG + Intronic
1152547263 17:81007550-81007572 TTACCTCTTAATTTCCAACCTGG + Intronic
1156650826 18:39225412-39225434 TTGTCTTTTTATTTCAATTCAGG - Intergenic
1156999031 18:43502014-43502036 TTGGAGCTTCATTTCAATGCTGG + Intergenic
1157274748 18:46302557-46302579 TTTCCTCTTAGTTTCAATTCAGG - Intergenic
1158296161 18:55998984-55999006 TAGCCTCTTATTTCCAAAGCAGG + Intergenic
1164762820 19:30740610-30740632 TCTCCTCGTAATTTCAATTCCGG + Intergenic
1165477120 19:36037382-36037404 TTGCCTCTATATTTTACTGCTGG - Intronic
1166592507 19:44013141-44013163 TTGCTTCTGTATTTCCATGCAGG + Exonic
926611274 2:14950800-14950822 TTGCTTCTTAATTACTATCCTGG + Intergenic
928162065 2:28937522-28937544 TTGCCTTTTAATGTTAATGGAGG + Intronic
930073565 2:47388800-47388822 TTGCCTCTTAGTTCAAATTCAGG - Intergenic
930661786 2:54062041-54062063 TTGCCTCTGAATTCCATTTCAGG + Intronic
931169696 2:59789964-59789986 TTCACTCTTAATTTCTCTGCTGG + Intergenic
932915353 2:75852349-75852371 GTGTCTCTCAAATTCAATGCAGG - Intergenic
932956573 2:76357719-76357741 TTACCTCTAAAATTCAATGGAGG - Intergenic
933311899 2:80670958-80670980 TTGGCTCTTCATGACAATGCAGG + Intergenic
938283324 2:130083653-130083675 TTCACTCTTGATCTCAATGCCGG - Intronic
938333958 2:130472212-130472234 TTCACTCTTGATCTCAATGCCGG - Intronic
938355862 2:130648454-130648476 TTCACTCTTGATCTCAATGCCGG + Intronic
938432286 2:131255238-131255260 TTCACTCTTGATCTCAATGCCGG + Intronic
938475966 2:131613850-131613872 TTCACTCTTGATCTCAATGCCGG + Intergenic
938590642 2:132732814-132732836 TGGCCTCTTAATTTGACTGTGGG + Intronic
940857640 2:158741977-158741999 TTGCCTCTTAATGCGCATGCTGG - Intergenic
941580342 2:167289788-167289810 TGGCATCTTAATTTAAATGAAGG - Intergenic
941876987 2:170444014-170444036 TTGCCTCCACATTTCAGTGCTGG + Exonic
943734458 2:191339211-191339233 CTGCCTTTCAATTTCAATTCAGG - Intronic
1172103090 20:32497461-32497483 TTGCTTTTTATTTTGAATGCGGG - Intronic
1172377012 20:34451765-34451787 TATCCTCTTAATTTTATTGCAGG + Intronic
1177693453 21:24540468-24540490 GTGCCTCTAAAATTCAATGGTGG + Intergenic
1178614053 21:34114923-34114945 TAGCCTTTTGATTCCAATGCTGG + Intronic
1179972007 21:44841246-44841268 TTGCTCCATAATCTCAATGCTGG - Intergenic
1182438280 22:30345442-30345464 TTGGCCCTCAATTTCAAGGCAGG - Intronic
1183004709 22:34891466-34891488 TAGCCAGTTAATTTCAATTCTGG - Intergenic
951595587 3:24315040-24315062 TTGTCTTTTAATTCCAATTCAGG + Intronic
951814306 3:26736552-26736574 TTGTCTCTTATTTTCATTGAGGG - Intergenic
957531833 3:81450551-81450573 TTGCTTCTTAATTACATTTCTGG + Intergenic
959975907 3:112459503-112459525 TTGCCACTTAAATACAATGTAGG - Intergenic
960190019 3:114692639-114692661 TTGCCAGTGCATTTCAATGCAGG + Intronic
960376845 3:116913126-116913148 TTGCCTATTAATTTGAATATTGG - Intronic
965512622 3:169585262-169585284 TTACCTCTGAAGTTTAATGCAGG + Intronic
969546392 4:7832080-7832102 TTGCTTCTTAACCTCAAAGCAGG - Intronic
972795227 4:42410428-42410450 TTGACTGTTTATTTCAATCCTGG + Exonic
976597919 4:86911449-86911471 CTGCATCTTAATTTCATGGCTGG + Intronic
977331350 4:95641272-95641294 TTGCCTCTTGTTTTCATTGCTGG + Intergenic
980465059 4:133164350-133164372 TTGCCTCTGAAATTGAATTCTGG + Intronic
984290789 4:177791431-177791453 TTGCATCTTAATTTGCTTGCAGG - Intronic
987229379 5:15877418-15877440 TTGCCTGTTAATTTTCATGAGGG + Intronic
989774768 5:45191422-45191444 ATACCTCTTAATTTCAAAGTAGG - Intergenic
990311657 5:54545383-54545405 TTGCCTCTTTATTTTGATGGTGG + Intronic
990357383 5:54982903-54982925 TGTCCTCTTTATTTCAATGTAGG - Intronic
990710794 5:58577972-58577994 TTGCCTCTTCACTCCAATGGTGG - Intergenic
991225658 5:64268324-64268346 TTGCCTCTTAATTTATAATCTGG - Intronic
992546721 5:77820827-77820849 TGGCCTCTGGTTTTCAATGCGGG - Intronic
994992935 5:107020425-107020447 TTGCATTTTATTTTCAATGGGGG - Intergenic
998786405 5:145714449-145714471 TTGATTCTTATTTTCAAAGCAGG - Intronic
999004041 5:147956424-147956446 GTGCCTTTTAATTTCAATGCTGG - Intergenic
1001019582 5:168171953-168171975 TTGCCTCTTTATTCAAATGCTGG - Intronic
1002993798 6:2264001-2264023 TTGCCTGTTAATTGCAATCTGGG + Intergenic
1005149547 6:22733233-22733255 TTGGCTCTCATTTTCAATGATGG - Intergenic
1006921696 6:37631874-37631896 TTCCCTCTTAATCTCTATTCTGG - Exonic
1009506638 6:64490564-64490586 TCACATCTTAATTTGAATGCTGG - Intronic
1011030433 6:82917131-82917153 TTACATCTTTATTTCAATGCTGG - Intronic
1011273700 6:85606097-85606119 TTTCCTCTTAATTTCAAATAAGG + Intronic
1011959703 6:93072227-93072249 ATGCCTCTTTATCACAATGCTGG - Intergenic
1012375814 6:98560335-98560357 TTTCATTTTAATTTGAATGCTGG + Intergenic
1013140571 6:107329775-107329797 GTGCCTATTAATTACAATGTTGG + Intronic
1016747093 6:147592323-147592345 CTGCCTCTTCATTTCTATGGTGG - Intronic
1022033722 7:26515337-26515359 TTCACTCTTCATTTCAAGGCAGG - Intergenic
1023188988 7:37559063-37559085 TTGACACTTGATTTCAATTCTGG + Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1024480578 7:49857845-49857867 TTGCCTATGATTTTCAATCCTGG + Intronic
1028602548 7:92617813-92617835 TTGAATGTTTATTTCAATGCAGG - Intronic
1034783951 7:153908003-153908025 CAGCCTCTAAATTTCAATCCAGG - Intronic
1035359595 7:158302095-158302117 ATGCCTCCTAATTTCAGTGATGG + Intronic
1036127628 8:6077886-6077908 TTCCCCCTTAATTTCAGTGGTGG + Intergenic
1037230651 8:16653824-16653846 TTGCCACTTAATTTCAACCTAGG + Intergenic
1039274397 8:35919493-35919515 TTGGCTCTTATTTTCTATACTGG - Intergenic
1042311158 8:67380565-67380587 TTGCCTCTTAATGTGCATACTGG - Intergenic
1042879103 8:73467661-73467683 TTGCCTCCAAATTTAAATGATGG + Intronic
1044248166 8:89975275-89975297 ATGCCTCCTAATTTAAATCCAGG + Intronic
1044531029 8:93307602-93307624 TTGTTTCTTAATTTAAATGTTGG - Intergenic
1046366894 8:113245215-113245237 TTGCCTCTTGATTGAAATGTTGG + Intronic
1046975179 8:120266942-120266964 TTGCCTGTTCATTTCAAACCAGG + Intronic
1047481095 8:125283795-125283817 TTGCCTCTTTGTTTCAACTCAGG + Intronic
1047869649 8:129068662-129068684 ATGTTTCTTAATTTCAATTCTGG - Intergenic
1051564042 9:18476093-18476115 TTTCCACTTAATTTAAATGCAGG - Intronic
1051817856 9:21130893-21130915 ATGCATATTAATTTGAATGCAGG - Intergenic
1052526714 9:29628250-29628272 TTGCCTTTGAACTCCAATGCTGG + Intergenic
1056102270 9:83311323-83311345 CTGCCTATTAACTTAAATGCCGG - Intronic
1056222545 9:84464642-84464664 TTGACTCTGAAGTTCAATGCAGG - Intergenic
1057602792 9:96473163-96473185 CTGGCTCTTAACTTCAATGTGGG + Intronic
1057914297 9:99043758-99043780 TTGGCCCTAAACTTCAATGCTGG - Intronic
1058909674 9:109509170-109509192 TTTCCTGATAATTTCAATGAGGG - Intergenic
1060372982 9:123092088-123092110 CTGCCTCTTAATTTCATTGTAGG - Intronic
1186141762 X:6581949-6581971 TAGACTCCTAATTTCAATGTAGG - Intergenic
1187061044 X:15787540-15787562 TTGCTTGTTAATTTCATTACAGG - Exonic
1188255410 X:27956467-27956489 CTCCCTCTTAATATCAATGTGGG + Intergenic
1188562733 X:31488126-31488148 TTGACTCTTAATTCTAAGGCTGG + Intronic
1189302484 X:39962124-39962146 TTGCTTCTTGATTTGAATGCTGG - Intergenic
1193019796 X:76779605-76779627 TTTCCTCTGAATTTCAATGTTGG + Intergenic
1193723367 X:85013554-85013576 TTCCATCTTAATTTCATTGTTGG + Intronic
1194941602 X:100016921-100016943 CTACCTCTTAATTACAATGGGGG - Intergenic
1197135187 X:123052222-123052244 TTGCCTCTTCACTCCAATGATGG - Intergenic
1197694349 X:129534992-129535014 TTGCTACTTTATTTCTATGCGGG - Intergenic
1197901270 X:131375514-131375536 TTGCTTCTTATTTCCAATCCAGG + Intronic
1199732022 X:150643966-150643988 TCTCCTCTTAATTTCTTTGCAGG - Intronic