ID: 1067595135

View in Genome Browser
Species Human (GRCh38)
Location 10:47550701-47550723
Sequence GCCTCATTCGGAACTTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067595135_1067595140 28 Left 1067595135 10:47550701-47550723 CCAGGTGAAGTTCCGAATGAGGC No data
Right 1067595140 10:47550752-47550774 GGAGGCCCCGTCACCACTACCGG No data
1067595135_1067595138 10 Left 1067595135 10:47550701-47550723 CCAGGTGAAGTTCCGAATGAGGC No data
Right 1067595138 10:47550734-47550756 AGTGCTCTTTCCAACTTTGGAGG No data
1067595135_1067595137 7 Left 1067595135 10:47550701-47550723 CCAGGTGAAGTTCCGAATGAGGC No data
Right 1067595137 10:47550731-47550753 CAAAGTGCTCTTTCCAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067595135 Original CRISPR GCCTCATTCGGAACTTCACC TGG (reversed) Intergenic