ID: 1067596873

View in Genome Browser
Species Human (GRCh38)
Location 10:47565476-47565498
Sequence GGTCGCTGGGCCCGGGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067596873_1067596888 22 Left 1067596873 10:47565476-47565498 CCGGCGGCCCGGGCCCAGCGACC No data
Right 1067596888 10:47565521-47565543 TGAAAGCTGGACAGCCAGTCGGG No data
1067596873_1067596884 9 Left 1067596873 10:47565476-47565498 CCGGCGGCCCGGGCCCAGCGACC No data
Right 1067596884 10:47565508-47565530 CCCCGAAGCTCTCTGAAAGCTGG No data
1067596873_1067596889 23 Left 1067596873 10:47565476-47565498 CCGGCGGCCCGGGCCCAGCGACC No data
Right 1067596889 10:47565522-47565544 GAAAGCTGGACAGCCAGTCGGGG No data
1067596873_1067596887 21 Left 1067596873 10:47565476-47565498 CCGGCGGCCCGGGCCCAGCGACC No data
Right 1067596887 10:47565520-47565542 CTGAAAGCTGGACAGCCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067596873 Original CRISPR GGTCGCTGGGCCCGGGCCGC CGG (reversed) Intergenic
No off target data available for this crispr