ID: 1067598247

View in Genome Browser
Species Human (GRCh38)
Location 10:47576115-47576137
Sequence TATACTACCACAACTGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067598247_1067598252 4 Left 1067598247 10:47576115-47576137 CCACAGCCAGTTGTGGTAGTATA No data
Right 1067598252 10:47576142-47576164 TATGGTCCCAGCTACTCAGAAGG 0: 26
1: 838
2: 12094
3: 73277
4: 195843
1067598247_1067598257 17 Left 1067598247 10:47576115-47576137 CCACAGCCAGTTGTGGTAGTATA No data
Right 1067598257 10:47576155-47576177 ACTCAGAAGGCTGAGGCAGGAGG 0: 392
1: 5972
2: 13874
3: 31033
4: 45483
1067598247_1067598256 14 Left 1067598247 10:47576115-47576137 CCACAGCCAGTTGTGGTAGTATA No data
Right 1067598256 10:47576152-47576174 GCTACTCAGAAGGCTGAGGCAGG 0: 2887
1: 85071
2: 182808
3: 212496
4: 143787
1067598247_1067598254 10 Left 1067598247 10:47576115-47576137 CCACAGCCAGTTGTGGTAGTATA No data
Right 1067598254 10:47576148-47576170 CCCAGCTACTCAGAAGGCTGAGG 0: 3774
1: 101495
2: 206159
3: 237850
4: 152587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067598247 Original CRISPR TATACTACCACAACTGGCTG TGG (reversed) Intergenic
No off target data available for this crispr