ID: 1067598252

View in Genome Browser
Species Human (GRCh38)
Location 10:47576142-47576164
Sequence TATGGTCCCAGCTACTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282078
Summary {0: 26, 1: 838, 2: 12094, 3: 73277, 4: 195843}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067598249_1067598252 -2 Left 1067598249 10:47576121-47576143 CCAGTTGTGGTAGTATAGGCCTA No data
Right 1067598252 10:47576142-47576164 TATGGTCCCAGCTACTCAGAAGG 0: 26
1: 838
2: 12094
3: 73277
4: 195843
1067598247_1067598252 4 Left 1067598247 10:47576115-47576137 CCACAGCCAGTTGTGGTAGTATA No data
Right 1067598252 10:47576142-47576164 TATGGTCCCAGCTACTCAGAAGG 0: 26
1: 838
2: 12094
3: 73277
4: 195843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067598252 Original CRISPR TATGGTCCCAGCTACTCAGA AGG Intergenic
Too many off-targets to display for this crispr