ID: 1067598254

View in Genome Browser
Species Human (GRCh38)
Location 10:47576148-47576170
Sequence CCCAGCTACTCAGAAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 701865
Summary {0: 3774, 1: 101495, 2: 206159, 3: 237850, 4: 152587}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067598247_1067598254 10 Left 1067598247 10:47576115-47576137 CCACAGCCAGTTGTGGTAGTATA No data
Right 1067598254 10:47576148-47576170 CCCAGCTACTCAGAAGGCTGAGG 0: 3774
1: 101495
2: 206159
3: 237850
4: 152587
1067598249_1067598254 4 Left 1067598249 10:47576121-47576143 CCAGTTGTGGTAGTATAGGCCTA No data
Right 1067598254 10:47576148-47576170 CCCAGCTACTCAGAAGGCTGAGG 0: 3774
1: 101495
2: 206159
3: 237850
4: 152587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067598254 Original CRISPR CCCAGCTACTCAGAAGGCTG AGG Intergenic
Too many off-targets to display for this crispr