ID: 1067598256

View in Genome Browser
Species Human (GRCh38)
Location 10:47576152-47576174
Sequence GCTACTCAGAAGGCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 627049
Summary {0: 2887, 1: 85071, 2: 182808, 3: 212496, 4: 143787}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067598249_1067598256 8 Left 1067598249 10:47576121-47576143 CCAGTTGTGGTAGTATAGGCCTA No data
Right 1067598256 10:47576152-47576174 GCTACTCAGAAGGCTGAGGCAGG 0: 2887
1: 85071
2: 182808
3: 212496
4: 143787
1067598247_1067598256 14 Left 1067598247 10:47576115-47576137 CCACAGCCAGTTGTGGTAGTATA No data
Right 1067598256 10:47576152-47576174 GCTACTCAGAAGGCTGAGGCAGG 0: 2887
1: 85071
2: 182808
3: 212496
4: 143787

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067598256 Original CRISPR GCTACTCAGAAGGCTGAGGC AGG Intergenic
Too many off-targets to display for this crispr