ID: 1067598257

View in Genome Browser
Species Human (GRCh38)
Location 10:47576155-47576177
Sequence ACTCAGAAGGCTGAGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96754
Summary {0: 392, 1: 5972, 2: 13874, 3: 31033, 4: 45483}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067598251_1067598257 -8 Left 1067598251 10:47576140-47576162 CCTATGGTCCCAGCTACTCAGAA 0: 33
1: 885
2: 12123
3: 73583
4: 195787
Right 1067598257 10:47576155-47576177 ACTCAGAAGGCTGAGGCAGGAGG 0: 392
1: 5972
2: 13874
3: 31033
4: 45483
1067598249_1067598257 11 Left 1067598249 10:47576121-47576143 CCAGTTGTGGTAGTATAGGCCTA No data
Right 1067598257 10:47576155-47576177 ACTCAGAAGGCTGAGGCAGGAGG 0: 392
1: 5972
2: 13874
3: 31033
4: 45483
1067598247_1067598257 17 Left 1067598247 10:47576115-47576137 CCACAGCCAGTTGTGGTAGTATA No data
Right 1067598257 10:47576155-47576177 ACTCAGAAGGCTGAGGCAGGAGG 0: 392
1: 5972
2: 13874
3: 31033
4: 45483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067598257 Original CRISPR ACTCAGAAGGCTGAGGCAGG AGG Intergenic
Too many off-targets to display for this crispr