ID: 1067599271

View in Genome Browser
Species Human (GRCh38)
Location 10:47583762-47583784
Sequence CCTCTGGCTCTCTGCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067599271_1067599276 16 Left 1067599271 10:47583762-47583784 CCTGCAGGGCAGAGAGCCAGAGG No data
Right 1067599276 10:47583801-47583823 TCCTGTTTAGTCCACAGCAAAGG No data
1067599271_1067599278 21 Left 1067599271 10:47583762-47583784 CCTGCAGGGCAGAGAGCCAGAGG No data
Right 1067599278 10:47583806-47583828 TTTAGTCCACAGCAAAGGTGCGG No data
1067599271_1067599273 -8 Left 1067599271 10:47583762-47583784 CCTGCAGGGCAGAGAGCCAGAGG No data
Right 1067599273 10:47583777-47583799 GCCAGAGGACTGTAATCCAGTGG No data
1067599271_1067599281 29 Left 1067599271 10:47583762-47583784 CCTGCAGGGCAGAGAGCCAGAGG No data
Right 1067599281 10:47583814-47583836 ACAGCAAAGGTGCGGCTGGCTGG No data
1067599271_1067599279 25 Left 1067599271 10:47583762-47583784 CCTGCAGGGCAGAGAGCCAGAGG No data
Right 1067599279 10:47583810-47583832 GTCCACAGCAAAGGTGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067599271 Original CRISPR CCTCTGGCTCTCTGCCCTGC AGG (reversed) Intergenic
No off target data available for this crispr