ID: 1067599274

View in Genome Browser
Species Human (GRCh38)
Location 10:47583778-47583800
Sequence ACCACTGGATTACAGTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067599274_1067599276 0 Left 1067599274 10:47583778-47583800 CCAGAGGACTGTAATCCAGTGGT No data
Right 1067599276 10:47583801-47583823 TCCTGTTTAGTCCACAGCAAAGG No data
1067599274_1067599278 5 Left 1067599274 10:47583778-47583800 CCAGAGGACTGTAATCCAGTGGT No data
Right 1067599278 10:47583806-47583828 TTTAGTCCACAGCAAAGGTGCGG No data
1067599274_1067599281 13 Left 1067599274 10:47583778-47583800 CCAGAGGACTGTAATCCAGTGGT No data
Right 1067599281 10:47583814-47583836 ACAGCAAAGGTGCGGCTGGCTGG No data
1067599274_1067599279 9 Left 1067599274 10:47583778-47583800 CCAGAGGACTGTAATCCAGTGGT No data
Right 1067599279 10:47583810-47583832 GTCCACAGCAAAGGTGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067599274 Original CRISPR ACCACTGGATTACAGTCCTC TGG (reversed) Intergenic
No off target data available for this crispr