ID: 1067599275

View in Genome Browser
Species Human (GRCh38)
Location 10:47583793-47583815
Sequence GTGGACTAAACAGGAACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067599275_1067599279 -6 Left 1067599275 10:47583793-47583815 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1067599279 10:47583810-47583832 GTCCACAGCAAAGGTGCGGCTGG No data
1067599275_1067599281 -2 Left 1067599275 10:47583793-47583815 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1067599281 10:47583814-47583836 ACAGCAAAGGTGCGGCTGGCTGG No data
1067599275_1067599278 -10 Left 1067599275 10:47583793-47583815 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1067599278 10:47583806-47583828 TTTAGTCCACAGCAAAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067599275 Original CRISPR GTGGACTAAACAGGAACCAC TGG (reversed) Intergenic
No off target data available for this crispr