ID: 1067599276

View in Genome Browser
Species Human (GRCh38)
Location 10:47583801-47583823
Sequence TCCTGTTTAGTCCACAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067599271_1067599276 16 Left 1067599271 10:47583762-47583784 CCTGCAGGGCAGAGAGCCAGAGG No data
Right 1067599276 10:47583801-47583823 TCCTGTTTAGTCCACAGCAAAGG No data
1067599274_1067599276 0 Left 1067599274 10:47583778-47583800 CCAGAGGACTGTAATCCAGTGGT No data
Right 1067599276 10:47583801-47583823 TCCTGTTTAGTCCACAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067599276 Original CRISPR TCCTGTTTAGTCCACAGCAA AGG Intergenic
No off target data available for this crispr