ID: 1067599279

View in Genome Browser
Species Human (GRCh38)
Location 10:47583810-47583832
Sequence GTCCACAGCAAAGGTGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067599274_1067599279 9 Left 1067599274 10:47583778-47583800 CCAGAGGACTGTAATCCAGTGGT No data
Right 1067599279 10:47583810-47583832 GTCCACAGCAAAGGTGCGGCTGG No data
1067599271_1067599279 25 Left 1067599271 10:47583762-47583784 CCTGCAGGGCAGAGAGCCAGAGG No data
Right 1067599279 10:47583810-47583832 GTCCACAGCAAAGGTGCGGCTGG No data
1067599275_1067599279 -6 Left 1067599275 10:47583793-47583815 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1067599279 10:47583810-47583832 GTCCACAGCAAAGGTGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067599279 Original CRISPR GTCCACAGCAAAGGTGCGGC TGG Intergenic
No off target data available for this crispr