ID: 1067599356

View in Genome Browser
Species Human (GRCh38)
Location 10:47584241-47584263
Sequence GACCCTAGGAGGGTGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067599347_1067599356 9 Left 1067599347 10:47584209-47584231 CCTCAAAACACATGATGAGATGG No data
Right 1067599356 10:47584241-47584263 GACCCTAGGAGGGTGGGGACTGG No data
1067599346_1067599356 10 Left 1067599346 10:47584208-47584230 CCCTCAAAACACATGATGAGATG No data
Right 1067599356 10:47584241-47584263 GACCCTAGGAGGGTGGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067599356 Original CRISPR GACCCTAGGAGGGTGGGGAC TGG Intergenic
No off target data available for this crispr