ID: 1067600874

View in Genome Browser
Species Human (GRCh38)
Location 10:47597960-47597982
Sequence ATCTTAAGCTAAAAGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067600872_1067600874 -6 Left 1067600872 10:47597943-47597965 CCTGAATAGCCAAAGCAATCTTA 0: 50
1: 453
2: 2106
3: 4065
4: 7020
Right 1067600874 10:47597960-47597982 ATCTTAAGCTAAAAGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067600874 Original CRISPR ATCTTAAGCTAAAAGAACAA AGG Intergenic
No off target data available for this crispr