ID: 1067603361

View in Genome Browser
Species Human (GRCh38)
Location 10:47633818-47633840
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 3, 1: 1, 2: 2, 3: 21, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067603361_1067603365 23 Left 1067603361 10:47633818-47633840 CCTAGTATTTCAAAATACCACTC 0: 3
1: 1
2: 2
3: 21
4: 202
Right 1067603365 10:47633864-47633886 TAGCTTAATTATTTAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067603361 Original CRISPR GAGTGGTATTTTGAAATACT AGG (reversed) Intergenic
903823630 1:26124906-26124928 TAGTGATATTTGGAAATACCTGG + Exonic
906252244 1:44319569-44319591 GAGGGGAATTTTGGAATCCTTGG - Intronic
906755442 1:48310028-48310050 GAGTGGTATTCTAAAATCCCAGG + Intronic
907990889 1:59581684-59581706 GCCAGGTATTTTGAAATATTTGG + Intronic
908153909 1:61333228-61333250 AAGTGGTATTTTGAAGTAGTTGG - Intronic
909513243 1:76478564-76478586 GAATGGGAGTTAGAAATACTGGG - Intronic
912061101 1:105671561-105671583 GAGTGAGATTTTGAAATCTTTGG - Intergenic
912906082 1:113708685-113708707 GTGTGGTATTAAGAAATACAGGG + Intronic
915882509 1:159686936-159686958 GCATGGGATTTTGGAATACTGGG - Intergenic
916655306 1:166870180-166870202 GAGTCATATTCTGAAGTACTAGG - Intronic
917385124 1:174464378-174464400 GAGTTCTATTTTGGAATACTTGG - Intronic
918117551 1:181509890-181509912 GAGTGGAATTTTAAAATAGAAGG + Intronic
918307436 1:183259973-183259995 GAGTGGAATGGTGAAATACACGG - Intronic
919975253 1:202606424-202606446 GAGTAGTATCTAGAAATCCTTGG - Intronic
920975414 1:210781141-210781163 GAGTTATATTTTGTAATCCTTGG + Intronic
923393634 1:233538457-233538479 GAATGGTATTTTGAAGTGATAGG + Intergenic
923663346 1:235977820-235977842 GAGTGTTGCTGTGAAATACTTGG + Exonic
924284834 1:242475689-242475711 CAGTGGCATTCTGAGATACTGGG - Intronic
1065477090 10:26151263-26151285 GAGAGGGATTTTTAAATATTTGG + Intronic
1065665784 10:28058739-28058761 AACTGACATTTTGAAATACTTGG - Intronic
1065824415 10:29556911-29556933 GAGTGGTCTTTTGAAAAATAGGG - Intronic
1066478440 10:35771240-35771262 GAGTGGTATTTTAAAAGGCCAGG + Intergenic
1067491305 10:46706562-46706584 GAGTGGTATTTTGAAATACTAGG + Intergenic
1067603361 10:47633818-47633840 GAGTGGTATTTTGAAATACTAGG - Intergenic
1068333032 10:55597779-55597801 GAGTGGTATTTTGAAATACTAGG - Intronic
1068829795 10:61480420-61480442 GAGTGGCATTTGGAAATAAGAGG + Intergenic
1069166364 10:65165778-65165800 TAGTTTTATTTTGAAATTCTGGG - Intergenic
1076087110 10:127642976-127642998 AAGTGATATTCTGAAGTACTAGG + Intergenic
1080524631 11:33102434-33102456 AAGTGGTATTTGGAAAAAGTAGG - Intronic
1080961234 11:37162798-37162820 GAATTGTACTTTGAAATAGTGGG + Intergenic
1081164731 11:39793627-39793649 CAGTGTTATTCTGAAATACTGGG - Intergenic
1081355256 11:42104897-42104919 GAGTCACATTTTGAAAAACTGGG - Intergenic
1083547439 11:63559372-63559394 GGGTGGCATTTTGAAACAGTAGG + Intronic
1084443878 11:69192274-69192296 GAGTGGCATATTGAAATAGCCGG + Intergenic
1084886467 11:72211448-72211470 CAGTAGTATTTAGAAAAACTAGG + Intergenic
1086306676 11:85487004-85487026 CAGTGGTATCTTGAACTTCTCGG - Intronic
1087334559 11:96826830-96826852 TAGTCACATTTTGAAATACTGGG + Intergenic
1089050423 11:115540486-115540508 TAATGGTATTTTGAAAAACTAGG + Intergenic
1093474530 12:19539907-19539929 GAGTGGATTTGAGAAATACTTGG + Intronic
1094091196 12:26652153-26652175 GAGTGGTTTTTGGAGAAACTGGG - Intronic
1094232977 12:28129022-28129044 GGGTGGAAATTTGAAAGACTGGG + Intergenic
1098483452 12:70993310-70993332 GAGTGGTATTTTTCAATTATAGG + Intergenic
1100684107 12:96966525-96966547 GAGACATATTTTGAAATATTAGG + Intergenic
1101390756 12:104297850-104297872 GAGTGTTATTTTGATAGACAGGG - Intronic
1102598404 12:114010900-114010922 TAGTCATATTCTGAAATACTGGG + Intergenic
1103091731 12:118103036-118103058 GCTTTTTATTTTGAAATACTTGG - Intronic
1106055721 13:26234747-26234769 GAGTGGTAAGATCAAATACTGGG - Intergenic
1108683094 13:52796186-52796208 GAGTTGCATTTTGAAAGAATTGG - Intergenic
1108984081 13:56560639-56560661 AAGAAGTATTCTGAAATACTAGG + Intergenic
1109014199 13:56987600-56987622 AAGTTGTATTTAGAAATAATTGG + Intergenic
1110565733 13:76955979-76956001 GAGAAGTAAATTGAAATACTAGG + Intronic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112483487 13:99798884-99798906 AAGTGGGATTTTTAAATCCTGGG + Intronic
1112924644 13:104659266-104659288 GAGTGCTATTTCAAAATAGTTGG + Intergenic
1113102853 13:106738807-106738829 GAGTAGAATTTGGAAGTACTGGG + Intergenic
1114056519 14:18972978-18973000 GAATGTTATTTTGAAATCCTAGG + Intronic
1114106031 14:19428749-19428771 GAATGTTATTTTGAAATCCTAGG - Intronic
1115062986 14:29216762-29216784 GAGTGATATTTTGAAAAAGGGGG + Intergenic
1115835789 14:37400460-37400482 GATTGGTATTTGAATATACTGGG + Intronic
1116622945 14:47228933-47228955 GACTGGAATTTTGATATATTGGG - Intronic
1117178694 14:53170872-53170894 GAGTGGAACTAAGAAATACTGGG + Intergenic
1117852264 14:59986864-59986886 AAGTGGTATTTTCAAATTTTAGG + Intronic
1118113026 14:62743937-62743959 GAATGGTAGTTTCAAAAACTTGG - Intronic
1118175951 14:63440200-63440222 GAGGGGTGTTCTGAAATACACGG + Intronic
1120088561 14:80304684-80304706 GGCTGGTATCTTGAAATACTAGG - Intronic
1121181065 14:91929233-91929255 GGCAGTTATTTTGAAATACTTGG - Intronic
1123498904 15:20861249-20861271 GAATGTTATTTTGAATTCCTAGG - Intronic
1123556140 15:21434868-21434890 GAATGTTATTTTGAATTCCTAGG - Intronic
1123592380 15:21872214-21872236 GAATGTTATTTTGAATTCCTAGG - Intergenic
1123764804 15:23467205-23467227 TAGTAGTATTTTGAACCACTAGG - Intergenic
1124062924 15:26311926-26311948 GAGTTCTATTTTAAGATACTTGG - Intergenic
1125594888 15:40878407-40878429 GAGTGGCATTTTAAAAGACCTGG + Intergenic
1126752111 15:51886805-51886827 GAGTGGTATTCTGAAATTTTTGG - Intronic
1127357267 15:58212295-58212317 AAGAGCTATTTTGAAATTCTTGG + Intronic
1127416121 15:58758893-58758915 GTCTGGTCTTTTGAATTACTGGG + Intergenic
1129555750 15:76507098-76507120 CAGTTATATTCTGAAATACTAGG - Intronic
1202964481 15_KI270727v1_random:162071-162093 GAATGTTATTTTGAATTCCTAGG - Intergenic
1135229749 16:20694746-20694768 CAGTGGTGTTCTGAAATATTGGG - Intronic
1135320539 16:21493071-21493093 GAGTGGTATTGAGAAATTGTAGG - Intergenic
1135373374 16:21924561-21924583 GAGTGGTATTGAGAAATTGTAGG - Intergenic
1135438415 16:22446141-22446163 GAGTGGTATTGAGAAATTGTAGG + Intergenic
1137658502 16:50182415-50182437 AAGAGGTATTTTGAAATTCTAGG - Intronic
1137804287 16:51288727-51288749 GAGTGATATTTTAAAATGTTGGG + Intergenic
1138279680 16:55763151-55763173 AAAAGGTATTTTGAAAGACTTGG - Intergenic
1138288831 16:55830499-55830521 AAAAGGTATTTTGAAAGACTTGG + Intronic
1139136426 16:64210224-64210246 GATTTGTATTCTGTAATACTTGG - Intergenic
1140047443 16:71451307-71451329 GAGGGCAATTATGAAATACTGGG - Intronic
1149332687 17:55602933-55602955 GAGTAGTATTTTTAAGTATTGGG - Intergenic
1150885642 17:69082614-69082636 GAGGGGTACTTGGAAAGACTTGG - Intronic
1151080418 17:71323135-71323157 CAGTCATATTTTGACATACTAGG - Intergenic
1154028649 18:10730196-10730218 GAGTTGTATTGTGAAGTAGTAGG - Intronic
1154456947 18:14538009-14538031 GAATGTTATTTTGAATTCCTAGG - Intronic
1156413298 18:36857779-36857801 TGGTGGTGTTTTTAAATACTTGG + Intronic
1157018932 18:43755744-43755766 CAGTCATATTTTAAAATACTAGG - Intergenic
1159156824 18:64594285-64594307 GAGAGCCATTTTGAAATACATGG + Intergenic
1159230644 18:65604299-65604321 GAGTCGTATTTTGATATGCTAGG - Intergenic
1167200261 19:48060232-48060254 AATTGGTATATTGACATACTAGG - Intronic
927351877 2:22125481-22125503 GTGGGGTATTTAGATATACTAGG - Intergenic
927633922 2:24797856-24797878 GAGTGGTTTTGTAAAATAATGGG + Intronic
929586855 2:43121752-43121774 GAGTTGTATTTTGAAAAAAGAGG + Intergenic
929778058 2:44940891-44940913 GACTGTTATTTTAAAATACAGGG + Intergenic
930430832 2:51273948-51273970 GAATTATATTTTGAAAGACTAGG - Intergenic
930560954 2:52959122-52959144 CAGTCATATTCTGAAATACTGGG - Intergenic
933826397 2:86164885-86164907 GAGTTGGATTTGGTAATACTAGG - Intronic
934958918 2:98649961-98649983 GACAGTTATTTTGAATTACTGGG - Intronic
935740760 2:106145579-106145601 GACTGGTAGTTTGAAATTTTAGG - Intronic
937819684 2:126295514-126295536 GAGATGTGTTTTGAAATATTTGG - Intergenic
938336428 2:130503653-130503675 GAATGTTATTTTGAATTCCTAGG - Intronic
938353395 2:130617009-130617031 GAATGTTATTTTGAATTCCTAGG + Intronic
939207824 2:139130432-139130454 GATTTGGATTTTGAAGTACTAGG - Intergenic
940329718 2:152461293-152461315 GAATGATATTTTAATATACTGGG - Intronic
940523825 2:154785883-154785905 GAGTGACATTCTGACATACTGGG + Intronic
940793915 2:158056805-158056827 AGGTGGTATTCTGAAGTACTGGG + Intronic
941046508 2:160682004-160682026 CTGTGGTATTTTAAAATACCAGG - Intergenic
941172144 2:162151850-162151872 GAGTTGTATTTTAAAATAATTGG - Intronic
941948504 2:171127741-171127763 GAGAGGTATTTTAAATTAGTGGG - Intronic
942964877 2:181879953-181879975 GAGTGGTATTTCTGAATGCTTGG + Intergenic
944847970 2:203687956-203687978 AAGTAATATTTTGAGATACTTGG - Intergenic
945396070 2:209320052-209320074 GATTGAAATTCTGAAATACTTGG + Intergenic
945705752 2:213229307-213229329 AAGTGGTATTTTTAAATGGTAGG + Intergenic
946195556 2:218030753-218030775 GTGTGCTGTTTTGAAATACACGG + Intergenic
1169778876 20:9286974-9286996 GAGTGATGTTTTGAGATAGTGGG + Intronic
1173932874 20:46836476-46836498 GCTTTGTAGTTTGAAATACTTGG + Intergenic
1174527474 20:51185169-51185191 GAAGGGTATTTTGAAGTGCTTGG + Intergenic
1174981494 20:55400214-55400236 AAGTTGTATTTTGCAAAACTGGG - Intergenic
1176817213 21:13615341-13615363 GAATGTTATTTTGAATTCCTAGG + Intronic
1177057049 21:16319167-16319189 GTGTGGTATGTTGAAAGACAAGG + Intergenic
1177200853 21:17954181-17954203 GAGTGATATTTTGCAATAAGTGG + Intronic
1180475005 22:15695589-15695611 GAATGTTATTTTGAAATCCTAGG + Intronic
1181566049 22:23738648-23738670 TAGTGATATATTGAAAAACTCGG - Intergenic
1181744318 22:24945272-24945294 GAGTGGTCTTTTGAAAACCTAGG - Intronic
949300077 3:2573651-2573673 CAGTAGTGTTTTGAAAAACTTGG + Intronic
949567350 3:5257279-5257301 GAGTTGAATTTTGAAAGATTGGG + Intergenic
949672468 3:6415511-6415533 AAGAGGTTTTTTAAAATACTTGG + Intergenic
951092267 3:18587987-18588009 GGGTCATATTCTGAAATACTAGG + Intergenic
951507587 3:23465670-23465692 GAGTGGGATTTAGAGATACAGGG - Intronic
954720549 3:52558451-52558473 GGATGGTATTTTGAATTCCTGGG - Intronic
956148537 3:66216996-66217018 CAGTGGTATCATGAAATACCTGG + Intronic
956154669 3:66282569-66282591 GAGTGGTATTTAGAAACTATAGG + Intronic
960162308 3:114363855-114363877 AAGTGGTATTTTGCATTTCTAGG + Intronic
960634153 3:119767482-119767504 GAGTTGTATTTACAAATACTTGG + Intergenic
961511403 3:127406015-127406037 GTGGGGTATTTTGAAGTACTGGG - Intergenic
962669233 3:137688156-137688178 GTGGGGAATTTTGAAACACTTGG - Intergenic
962783937 3:138748804-138748826 TAGTGGTATTTTGTAGTATTAGG + Intronic
962811724 3:138964113-138964135 GAATGGGATTTTGAAATAGTAGG + Intergenic
962910720 3:139847161-139847183 CAGTGATATTCTGAAGTACTGGG - Intergenic
963063136 3:141241195-141241217 GAGTGGTATATTGATATACTGGG + Intronic
963518417 3:146336260-146336282 GAGTGCTATTTGGAGATATTTGG - Intergenic
964820345 3:160761927-160761949 GAGAGGTAATTTGAAACATTGGG - Intronic
965906638 3:173715967-173715989 GAGTTGTATTTTAAATTATTTGG + Intronic
967616384 3:191573200-191573222 CAGTCATATTTTGAGATACTGGG - Intergenic
969660826 4:8526494-8526516 GGGTGGTATTTGGAGAGACTGGG + Intergenic
970528585 4:16958411-16958433 CAGTTGTAATTTGAAATACAGGG - Intergenic
974663617 4:64928255-64928277 TAGAGGTTTTTTAAAATACTTGG + Intergenic
977643204 4:99380871-99380893 GAGTGTCATTTTGTAAAACTGGG - Intergenic
978842952 4:113236037-113236059 GAATGGTAAATTGAAAGACTGGG - Intronic
978863978 4:113485109-113485131 GATTGTTCTTTTGAAAGACTGGG + Intronic
982253156 4:153427539-153427561 GAGTGGAAGTTGAAAATACTGGG - Intergenic
982326415 4:154133845-154133867 GGGTGGTATCTGGAAATAATGGG + Intergenic
983742022 4:171147516-171147538 GAGTATTATTTCAAAATACTGGG + Intergenic
983751342 4:171275908-171275930 GAATGAAATTCTGAAATACTTGG + Intergenic
984465810 4:180099747-180099769 CAGTTGTATTATGAAATACTTGG + Intergenic
984666364 4:182433615-182433637 GAGTGGTCTCCTGAAATAATAGG + Intronic
985337492 4:188912535-188912557 AATTGATATTTTGAAATAGTAGG + Intergenic
986614425 5:9601947-9601969 GAGTCACATTTTGAGATACTAGG - Intergenic
989220991 5:38963615-38963637 AAGTGGAATTTTTAAATATTGGG + Intronic
990895347 5:60693989-60694011 TAGTGATATTTGGAAATATTGGG - Intronic
991483813 5:67113004-67113026 GAGTGGTATTTCAAAAAACAGGG + Intronic
993535862 5:89085883-89085905 GAGTGTCATTTTGACATTCTGGG - Intergenic
993772673 5:91949852-91949874 GATTTGCATTTTTAAATACTAGG - Intergenic
994784725 5:104142894-104142916 GAGATGTATGTTGAAGTACTGGG - Intergenic
998844091 5:146288760-146288782 GAGGGAAATTTTGCAATACTTGG - Exonic
999118727 5:149189835-149189857 GAGTGGAATTTGGAATTGCTGGG - Intronic
1004086513 6:12454596-12454618 GAGAGGTATTTTGGAAGACTGGG + Intergenic
1006935510 6:37714750-37714772 CACTGAGATTTTGAAATACTTGG - Intergenic
1007145592 6:39626683-39626705 AAGTTGTTTTTTGAAATACCAGG - Intronic
1007171463 6:39866757-39866779 AAATGGTATTTTGAGATACCTGG + Intronic
1007604781 6:43109610-43109632 GAGTGTTATTTTTAAAATCTTGG + Intronic
1007939098 6:45760410-45760432 CAGTAATATTTTGAAATACCAGG - Intergenic
1008668084 6:53737304-53737326 GAGTGGCTCTTTGAAATATTAGG + Intergenic
1009283379 6:61780031-61780053 GAGAAGTATTTTGAAGTACACGG + Intronic
1009528894 6:64784741-64784763 GACTGGCATTTTCAAATTCTCGG + Intronic
1013165739 6:107590339-107590361 GACTGGTCTTTTGAAAACCTGGG - Intronic
1013839624 6:114375407-114375429 AAGTAACATTTTGAAATACTGGG - Intergenic
1014838111 6:126183298-126183320 GAGTGCTATTTGGAAAGACTCGG - Intergenic
1015109704 6:129578385-129578407 GAGAGTCATTTTTAAATACTTGG + Exonic
1017938825 6:159033016-159033038 AAGTAGTATTTTGAAAAACTTGG + Intergenic
1020205379 7:6110423-6110445 GAGTCCTATTTTAAAATATTAGG - Intronic
1020528224 7:9292834-9292856 GAGTTTTATCTTGAAATCCTAGG + Intergenic
1021443651 7:20709582-20709604 CAATGGTATTTTTAAAAACTAGG + Intronic
1023528833 7:41132558-41132580 GTGATGTATTTTGAAATCCTAGG + Intergenic
1024514002 7:50228154-50228176 AAGTGGAATTTTTAAATACATGG - Intergenic
1024703745 7:51934591-51934613 GATTGGTATTTTTAAATGTTTGG + Intergenic
1024827480 7:53408616-53408638 GATTTGTCTTTTGAAATAATAGG - Intergenic
1028876427 7:95828335-95828357 GAGTGTTGTTTTGCAATAATAGG - Intronic
1029351309 7:100015096-100015118 GAGTGGTATTTTCAAATACTTGG - Intergenic
1031346446 7:120672737-120672759 CAGTCATATTTTAAAATACTGGG - Intronic
1031549313 7:123088936-123088958 CAGTGTTGTTTTGAAATCCTTGG - Intergenic
1031550077 7:123099311-123099333 GAGTGGAATTGTGAAAGCCTGGG - Intergenic
1031652673 7:124310207-124310229 GAATGTTAATTTGAAAAACTGGG - Intergenic
1035777654 8:2201379-2201401 GAGTGGTATCTTGAAGAAATGGG + Intergenic
1037742706 8:21620223-21620245 GAATGCTATTTTGAAATATGTGG + Intergenic
1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG + Intergenic
1038942263 8:32318096-32318118 GTTTGGTATTTTGAAGTATTTGG + Intronic
1039629889 8:39099378-39099400 AAAAGGTATTTTGAAACACTTGG - Intronic
1040441061 8:47443096-47443118 CAGTGGGATTTAGAAATTCTTGG - Intronic
1040850461 8:51896356-51896378 TATTGGTATTTTAAAATATTTGG - Intronic
1042685343 8:71432710-71432732 CAGTTGTATTCTGAAGTACTGGG + Intronic
1042805825 8:72769757-72769779 GAGTGGTTTTGTGAATTTCTGGG + Intronic
1043319224 8:78961508-78961530 AAGTGATATTTTGAAATACTAGG + Intergenic
1046095364 8:109552789-109552811 GTCTGGTATTTTAAAATACATGG - Intronic
1046975412 8:120270418-120270440 GGGTGTTATTTTTACATACTAGG + Intronic
1047682571 8:127269418-127269440 GATTTGTGTTTTGAAATACTTGG - Intergenic
1048513770 8:135086382-135086404 GAATGAAATCTTGAAATACTAGG - Intergenic
1050665006 9:7926046-7926068 GAGAAATATTTTGAAATATTAGG - Intergenic
1057476791 9:95409869-95409891 TATTGGTTTTTTGAAAAACTAGG + Intergenic
1059765157 9:117377133-117377155 GAGAGGTCTTTTGAACTCCTCGG + Intronic
1062161557 9:135083228-135083250 GAGTGGTACTTTGAAGAACAGGG - Intronic
1203530150 Un_GL000213v1:134150-134172 GAATGTTATTTTGAATTCCTAGG - Intergenic
1187084172 X:16024481-16024503 GATTGGTTTTTCCAAATACTAGG + Intergenic
1187990320 X:24863904-24863926 GAGTGCTACTTAAAAATACTTGG - Intronic
1188776287 X:34223413-34223435 GAGTATTATTTTTAAACACTTGG - Intergenic
1189658387 X:43271187-43271209 CAGTGGTATATTGAAATATGTGG - Intergenic
1191760564 X:64643474-64643496 GAGTGGTTTTTTGGTATGCTGGG - Intergenic
1195490417 X:105462299-105462321 CAGTGGCATTTTGAAAAATTAGG - Intronic
1195884257 X:109623823-109623845 GAGAGGCATTTGGAAGTACTGGG + Exonic
1197640001 X:128957046-128957068 GAGCAGTATTTTGCAATAGTGGG + Intergenic
1197981888 X:132226018-132226040 GAGTTGAATTCTGAACTACTTGG + Intergenic
1200367142 X:155678639-155678661 GTATGGCATTTTTAAATACTTGG + Intergenic