ID: 1067605764

View in Genome Browser
Species Human (GRCh38)
Location 10:47661099-47661121
Sequence AAACTAAAAACCATGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 52, 1: 57, 2: 38, 3: 63, 4: 353}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067605764_1067605772 17 Left 1067605764 10:47661099-47661121 CCTGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1067605772 10:47661139-47661161 TGGAAAGGAGGGATGAGGAAGGG No data
1067605764_1067605773 18 Left 1067605764 10:47661099-47661121 CCTGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1067605773 10:47661140-47661162 GGAAAGGAGGGATGAGGAAGGGG No data
1067605764_1067605774 27 Left 1067605764 10:47661099-47661121 CCTGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1067605774 10:47661149-47661171 GGATGAGGAAGGGGCTTTACTGG 0: 51
1: 55
2: 49
3: 49
4: 226
1067605764_1067605767 2 Left 1067605764 10:47661099-47661121 CCTGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1067605767 10:47661124-47661146 GTCTGTAGTGATAAGTGGAAAGG No data
1067605764_1067605768 5 Left 1067605764 10:47661099-47661121 CCTGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1067605768 10:47661127-47661149 TGTAGTGATAAGTGGAAAGGAGG No data
1067605764_1067605770 12 Left 1067605764 10:47661099-47661121 CCTGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1067605770 10:47661134-47661156 ATAAGTGGAAAGGAGGGATGAGG No data
1067605764_1067605771 16 Left 1067605764 10:47661099-47661121 CCTGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG No data
1067605764_1067605766 -3 Left 1067605764 10:47661099-47661121 CCTGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1067605766 10:47661119-47661141 TTTCTGTCTGTAGTGATAAGTGG No data
1067605764_1067605769 6 Left 1067605764 10:47661099-47661121 CCTGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1067605769 10:47661128-47661150 GTAGTGATAAGTGGAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067605764 Original CRISPR AAACTAAAAACCATGGCTTC AGG (reversed) Intergenic
900485088 1:2918925-2918947 AGACCAAAAACCATGGCCTCAGG - Intergenic
901602771 1:10434985-10435007 GTATTAAAAACCATGTCTTCGGG + Intronic
903786583 1:25865165-25865187 AAACAAAAAAACATTTCTTCTGG + Intronic
904511429 1:31012342-31012364 AAACTGAGAACCATGACTTGGGG + Intronic
908254180 1:62289109-62289131 AAACTAAAACCTATGTCTTCAGG - Intronic
908749041 1:67401957-67401979 AAAATAAAATCTCTGGCTTCAGG - Intergenic
910133167 1:83933610-83933632 AAAACTAAAGCCATGGCTTCTGG - Exonic
910254294 1:85231903-85231925 AAACAAAAAACAATGGATGCTGG - Intergenic
910256466 1:85253083-85253105 AAACTAAAAACCATGGCTTCAGG - Intronic
910816490 1:91296693-91296715 AAACTAAAAATCATTGTTTAAGG - Intronic
911044708 1:93618911-93618933 AAAAAAAAACCCACGGCTTCAGG - Intronic
911149518 1:94583710-94583732 AAACTAGGCACTATGGCTTCTGG + Intergenic
911705891 1:101012303-101012325 AAACTAAAAACCATGGCTTCAGG - Intronic
912328044 1:108787446-108787468 AAACTAAAAACCATGGCTTCAGG + Intronic
913175056 1:116265994-116266016 AAACTAAAAACCATGGCTTCAGG - Intergenic
915424578 1:155814038-155814060 AAATTAATAACAATGGCTTTAGG + Intronic
916275664 1:162990789-162990811 AATCTCATGACCATGGCTTCTGG + Intergenic
916334233 1:163651999-163652021 AAATTAAAAACTATGGAATCTGG + Intergenic
916851951 1:168712889-168712911 AAACTATAGACCTTGTCTTCAGG - Intronic
917033865 1:170724953-170724975 GAACTAAAAACCATTGCTCAAGG - Intronic
918301658 1:183209747-183209769 AGACTAATAACCTTGTCTTCAGG - Intronic
919217292 1:194574963-194574985 AAAGCTAAAACCATGGCTTCAGG + Intergenic
919980049 1:202637382-202637404 AAACCAAAAACCATGGACTAGGG + Intronic
920092042 1:203461779-203461801 AAAGTAAGAACTCTGGCTTCTGG + Intergenic
920357003 1:205381127-205381149 AATGTAATAACCATGGCCTCAGG - Intergenic
920817478 1:209348498-209348520 AAACTAAAAGCCATGGCTTCAGG - Intergenic
921007627 1:211110932-211110954 AAATTAGAAGCCATGGCCTCTGG + Intronic
921139507 1:212293026-212293048 AAACTAAAAACCATGGCTTCAGG + Intronic
922394911 1:225188152-225188174 AAAGTAAAAACCATGAATACAGG - Intronic
922674005 1:227540067-227540089 AAAATAAAAACCCTGCTTTCAGG - Intergenic
923699656 1:236287812-236287834 AAACTAAAAACCATGGCTTCAGG + Intergenic
924073507 1:240308471-240308493 AAACTAAACACCATGGCTTCAGG - Intronic
924268664 1:242309278-242309300 AAATTAAAAACCATGGCCTTGGG + Intronic
924828622 1:247568850-247568872 AAACTAAAAACCACTGCTCAAGG - Intronic
1063211915 10:3888339-3888361 AAGCTACAAACCAGGCCTTCAGG - Intergenic
1063624901 10:7679840-7679862 AAACTTAAAACCATGGCGGCAGG + Intergenic
1063675338 10:8136377-8136399 AATCTAGACTCCATGGCTTCTGG + Intergenic
1064443594 10:15373957-15373979 AAACTGAAAACGATGGCTTTAGG - Intergenic
1064930113 10:20615641-20615663 AAACAAATAACCATGGATTTGGG + Intergenic
1065030313 10:21579500-21579522 AAAAAAAAAACCAGGGCTTCAGG - Intronic
1065037693 10:21656842-21656864 AAACAAAGAGCTATGGCTTCTGG - Intronic
1065538519 10:26737798-26737820 ACACATAAAACCATGGCTTCGGG - Intronic
1065609415 10:27457351-27457373 AAAATAAAAACTAAGGCTTGAGG - Intergenic
1066156680 10:32685421-32685443 AAACTAAAAACCATGGCTTTGGG - Intronic
1066618338 10:37318951-37318973 AAACCCAAAACCATGGCATTGGG - Intronic
1066638956 10:37536428-37536450 AAACTAAAAACCATGGCTTCAGG - Intergenic
1066649457 10:37640617-37640639 GAACTAACAACCATGGGTTCAGG - Intergenic
1066687077 10:37991586-37991608 AAACTAAAAACCATGGAATCAGG - Intergenic
1066716242 10:38289490-38289512 AAATTAAAAACCATGGCTTCGGG - Intergenic
1067061008 10:43077899-43077921 CACCTAAAAACCGTGGTTTCTGG + Intronic
1067269869 10:44781669-44781691 AAACAAAAAACAAAGGCTGCAGG + Intergenic
1067488904 10:46679277-46679299 AAACTAAAAACCATGGCTTCAGG + Intergenic
1067605764 10:47661099-47661121 AAACTAAAAACCATGGCTTCAGG - Intergenic
1067859232 10:49827535-49827557 AAACTAAATACCACAGCTTCAGG + Intronic
1068835590 10:61548856-61548878 AAACTAAACACCAAAGCTCCGGG - Intergenic
1069180896 10:65357250-65357272 AAACTAAAACCCATGGTGTCAGG + Intergenic
1070127538 10:73634261-73634283 TAACTGAAAAACAAGGCTTCTGG + Intronic
1071358711 10:84823389-84823411 AAACTACAAACTATGGTTTGAGG - Intergenic
1071621323 10:87122458-87122480 AAACTAAAAACCATGGCTTCAGG - Intronic
1071868865 10:89769371-89769393 AAACTAAAAACCATGGCTTCAGG + Intronic
1071934075 10:90507271-90507293 AAACGAAAAACCATGGCTTTAGG - Intergenic
1072355190 10:94603217-94603239 AAACTAAAAACAATGAATACAGG - Intronic
1073027051 10:100495712-100495734 AAACCAAAAACCATGGCTTCAGG - Intronic
1073677234 10:105661856-105661878 AAACTAATAACCATGATTTATGG + Intergenic
1074612181 10:115032738-115032760 AAACTAAAAAACATTGCTAAAGG - Intergenic
1074794503 10:116928145-116928167 AAATTAAAAACAATGGCTGAAGG + Intronic
1074842042 10:117364010-117364032 AAATTAAAAATCAAGTCTTCTGG + Intronic
1075044364 10:119134338-119134360 AAAAAAAAAATCATGTCTTCTGG - Intronic
1076459405 10:130630254-130630276 AAACTAAAAATCATGGCTTCAGG - Intergenic
1078626758 11:12964985-12965007 AAAAAAAAATCCATGCCTTCTGG - Intergenic
1078727884 11:13948085-13948107 AAACTAAAAACCATGGCTTCAGG + Intergenic
1078932981 11:15927394-15927416 AAACCAATCACCATGGCCTCAGG + Intergenic
1078952795 11:16153962-16153984 AAAACAAAACCCATGGCTTTGGG + Intronic
1079282488 11:19099915-19099937 AAAATAAAAACTATGGCTTCAGG + Intergenic
1079294433 11:19219648-19219670 AAACTAAAAACCATAGCTTCAGG - Intergenic
1079805969 11:24931563-24931585 ATATAAACAACCATGGCTTCTGG - Intronic
1081210441 11:40326648-40326670 GAACAAAAAAACATTGCTTCTGG + Intronic
1081757885 11:45557505-45557527 AAAACAAAAACCATGGCCTCAGG + Intergenic
1082067711 11:47914438-47914460 AAAACAAAAACCATGGGCTCTGG - Intergenic
1082207896 11:49460686-49460708 AAACTAAAGACGAGGGCATCTGG - Intergenic
1082574781 11:54789000-54789022 GAACTACAAACCATTGCTCCAGG + Intergenic
1083003558 11:59320292-59320314 GAGCTAAAAACCATGGCATGAGG - Intergenic
1084635497 11:70389686-70389708 AAACTCAAAACCATGGCGTTGGG + Intergenic
1084837196 11:71811490-71811512 CAGCTAAATACCATGGCTTCTGG - Intergenic
1086889732 11:92243762-92243784 AAACTAAAGTCCTTGGCTTATGG - Intergenic
1087348471 11:97001090-97001112 AAACCAAAAACCACAGCTTCAGG - Intergenic
1087360635 11:97154763-97154785 AAAATAAAAACCATGGACACTGG + Intergenic
1087481596 11:98708100-98708122 AAACTCAAAATAATGGCTACAGG - Intergenic
1087741350 11:101890607-101890629 AAACTACAAACCATTCCTACTGG + Intergenic
1088105839 11:106205761-106205783 AAACAAAACAACATGGCCTCAGG - Intergenic
1088183207 11:107135380-107135402 ACACTAAAAACCATGGCTTCAGG + Intergenic
1089085491 11:115813597-115813619 AAACTTAAAATCATGGCTGAAGG + Intergenic
1089548619 11:119251566-119251588 AACCTAATAACCATGCCTTTTGG + Intronic
1089714511 11:120345133-120345155 AAACTAAAAACCATGGCTTCAGG - Intronic
1089949485 11:122511975-122511997 AAACTATCCACTATGGCTTCTGG - Intergenic
1089985870 11:122813108-122813130 AAAATAAAAAATATGCCTTCTGG + Exonic
1090435209 11:126681235-126681257 ACACAAAAACACATGGCTTCTGG - Intronic
1090746282 11:129707691-129707713 AAACTAAAAACCATGGTTTCAGG - Intergenic
1090836026 11:130454652-130454674 AAACACAACACCATGCCTTCTGG + Intronic
1091356118 11:134938892-134938914 AAACTAAAAACCATGGCTTCGGG + Intergenic
1092312538 12:7374063-7374085 AAACTAATAACCATGGCTTCAGG + Intronic
1092401508 12:8182589-8182611 CAGCTAAATACCATGGCTTCTGG + Intronic
1092403292 12:8196191-8196213 TACCTGAATACCATGGCTTCTGG + Intergenic
1092882678 12:12900201-12900223 AAACTAAAAGCCAGGGCTAGAGG - Intronic
1093247035 12:16751874-16751896 AAACTAAAAAACACAGCTTAAGG + Intergenic
1093551156 12:20413380-20413402 AAACAAAGATCCATGGCTTCAGG - Intronic
1093569974 12:20655559-20655581 AAACTAAAAACCATGGTTTCAGG + Intronic
1094653277 12:32398432-32398454 AAACAAAAAAGCATTTCTTCAGG + Intergenic
1095150114 12:38784343-38784365 AAACAAAAAAGCATGCCTACAGG + Intronic
1095351099 12:41213589-41213611 AAACTAAAAACTATGGCTTCAGG + Intronic
1095654952 12:44658411-44658433 AAACTATAAACCACTGCTTAAGG + Intronic
1096557496 12:52412307-52412329 GAGCTAAAAGCCTTGGCTTCTGG - Intergenic
1097312166 12:58131559-58131581 AAGCTTAAAAGCATGGATTCTGG - Intergenic
1097788563 12:63788988-63789010 AAACTAAAAGCCATGGCTTCAGG - Intronic
1098203142 12:68078537-68078559 AAACTAAAAACTATGGCTTCAGG + Intergenic
1098239166 12:68448835-68448857 AAACTAAAAACTATGGCTTCAGG - Intergenic
1098587219 12:72168254-72168276 AAACTAAAAACCACATTTTCAGG + Intronic
1098779669 12:74670738-74670760 AAACTTAAAATCATGGCTGAAGG - Intergenic
1099146889 12:79057815-79057837 AAACCAAAAATTATGGCTTCAGG + Intronic
1099174962 12:79410472-79410494 AGACTTAAAACCATGGCTTCAGG + Intronic
1099311939 12:81037323-81037345 AAACGATAAACCATAGCTTCAGG + Intronic
1099357068 12:81650750-81650772 AATCTAAAATCTCTGGCTTCAGG - Intronic
1099524927 12:83707169-83707191 AAACAACAAACCATGCCTACAGG + Intergenic
1100073518 12:90751157-90751179 AAACTACAAACCACTGCTTAAGG - Intergenic
1100135974 12:91553824-91553846 AAAATAAACCCCATGGGTTCAGG + Intergenic
1100335271 12:93623293-93623315 AAACTTATAATCATGGCTGCAGG - Intergenic
1100831420 12:98519498-98519520 ACTCTAAAAAACATGACTTCTGG - Intronic
1100979161 12:100151226-100151248 AAACTTAAATCTATGTCTTCAGG + Intergenic
1101051942 12:100873060-100873082 AAACTTAAAACCATGGCAGAAGG - Intronic
1101270605 12:103140058-103140080 GAACTAAAAACCAGGGCCTCAGG + Intergenic
1101676381 12:106920891-106920913 AAACAAAAAACCATGGTTTCAGG - Intergenic
1102330295 12:112022991-112023013 AAAGAAAAAAGAATGGCTTCAGG - Exonic
1103098244 12:118149155-118149177 AAACCAAAAACCATAGCTTCAGG + Intergenic
1104513202 12:129400422-129400444 AAACTAAAAACCATGGCTTCAGG - Intronic
1105712554 13:23026500-23026522 AAACTTAAAATCATGGCTGAGGG - Intergenic
1107303109 13:38986855-38986877 AGACTAAATACCAGAGCTTCTGG + Intronic
1107528281 13:41256125-41256147 GAAGAAAAAAACATGGCTTCAGG + Intronic
1108447276 13:50522095-50522117 AAAATTAAAAACGTGGCTTCTGG - Intronic
1109162132 13:58988679-58988701 AAACTTACAATCATGGCTTATGG - Intergenic
1109266739 13:60209404-60209426 AAAAGACAACCCATGGCTTCTGG + Intergenic
1109970542 13:69762487-69762509 GATCTAAAATCCATGTCTTCTGG + Intronic
1110520837 13:76474198-76474220 GAACTAAAAAGCATGGAATCTGG + Intergenic
1111818842 13:93189572-93189594 AAAATAAAAACCCTGTCCTCTGG + Intergenic
1112406106 13:99122081-99122103 AAATTAAAAATCATGTGTTCTGG - Intergenic
1112695425 13:101943030-101943052 AAAGTAAACACCATGGCTATGGG - Intronic
1113280704 13:108784220-108784242 AAAAAAAAAACCCTGACTTCAGG - Intronic
1113749096 13:112766275-112766297 AAATGAAAAACCATGGCTTCAGG - Intronic
1114863938 14:26564081-26564103 ACACTAAAGACCATGGGTTCTGG - Intronic
1116305038 14:43242128-43242150 AAAATAAAAACCATGAATTGTGG - Intergenic
1116429062 14:44824932-44824954 GAACTACAAACCATTGCTTAAGG + Intergenic
1117102433 14:52364160-52364182 AAACTAAAAACCATGGCTTCAGG + Intergenic
1117619270 14:57567909-57567931 AAACAAGAAACCATAGCTACAGG + Intronic
1118872011 14:69750928-69750950 AAACTAAAAACCCTGGCTTCAGG + Intronic
1119327369 14:73768816-73768838 AAACTAAAAATCAGAACTTCTGG + Intronic
1119606646 14:76024021-76024043 AAACTAAAAACTACGGGTTCAGG + Intronic
1120176008 14:81293974-81293996 AAACTGAATACCCAGGCTTCAGG - Intronic
1121914286 14:97821612-97821634 AAACTTAAAATCATGGCATAAGG - Intergenic
1122004689 14:98692451-98692473 AAAGTAAAATTGATGGCTTCAGG + Intergenic
1122677131 14:103424870-103424892 TAACCAAAAAACAGGGCTTCTGG - Intronic
1123773183 15:23549563-23549585 AAACTAAAAACTGTGGCTTCAGG + Intergenic
1124495970 15:30187326-30187348 AAACCAAAAACCATGGACTAGGG + Intergenic
1124747604 15:32351321-32351343 AAACCAAAAACCATGGACTAGGG - Intergenic
1125426818 15:39557020-39557042 AAACTAAAAGCCATGGCTTCAGG + Intergenic
1125578125 15:40768634-40768656 AAACTACACACCAGGGCTCCTGG + Intronic
1126917799 15:53484775-53484797 AAACTAAAAGCCATGGCTTTAGG + Intergenic
1126939188 15:53747192-53747214 AAAATAATAACTTTGGCTTCAGG - Intronic
1127012604 15:54646145-54646167 AAACAAAAAAGCATGCCTACAGG + Intergenic
1127037595 15:54935597-54935619 AAACTAAAAATCATAGGTACAGG - Intergenic
1129862088 15:78870980-78871002 AAACTAAAAACCATGGCTTCAGG + Intronic
1130719026 15:86367955-86367977 AAACTAATAAACATGGGTTAGGG + Intronic
1131024731 15:89130558-89130580 AAACTACAAACCATGGCTTTAGG + Intronic
1131344142 15:91630538-91630560 AAACTTAAAATCATGGCTGAGGG + Intergenic
1133252657 16:4494014-4494036 AAACTAGAAAACATGGCTGTCGG + Intronic
1133581502 16:7148971-7148993 AAGCAAAATACTATGGCTTCAGG - Intronic
1134814004 16:17191068-17191090 AAACTAAAAACCATGGCTTCAGG - Intronic
1135002348 16:18787349-18787371 AAACTAAGTACCATGGTTTCAGG + Intronic
1135425557 16:22332518-22332540 AAACTAAAAACCATGGCTTCAGG + Intronic
1136714914 16:32271018-32271040 AAACTAACAACCATGGCAGAAGG + Intergenic
1138367616 16:56494266-56494288 ACATTGAAAATCATGGCTTCAGG - Intronic
1138764790 16:59589150-59589172 ATACTAACCACCATTGCTTCTGG - Intergenic
1139173027 16:64653532-64653554 AAACTAAAAAAGAAAGCTTCAGG + Intergenic
1140203111 16:72910808-72910830 AAACAAAAAAACAGGGTTTCTGG + Intronic
1140340121 16:74149763-74149785 AAACTTACAATCATGGCTTAAGG - Intergenic
1140489372 16:75321580-75321602 AAACTGAAAAACATGGCTTCAGG - Intronic
1140937602 16:79689122-79689144 AAACTAAAATCCGTGGCTTCAGG - Intergenic
1203055139 16_KI270728v1_random:918751-918773 AAACTAACAACCATGGCAGAAGG - Intergenic
1143970726 17:10793371-10793393 AAACAAAAAATGATGGCTTCAGG + Intergenic
1144083171 17:11783164-11783186 AAACTAAAAACCATGGTTTCAGG - Intronic
1144276876 17:13678647-13678669 AAACTGAAAACCAGGTTTTCAGG + Intergenic
1144483076 17:15643470-15643492 CAACTGGAAACCAGGGCTTCCGG - Intronic
1144592048 17:16532579-16532601 AAACTAAAAACCGTGGCTTCAGG - Intergenic
1144645171 17:16968194-16968216 AAACTAAAAAACATTGCTGAAGG + Intronic
1145289001 17:21528386-21528408 TAACTCAAAACCTCGGCTTCGGG - Exonic
1147500994 17:40963402-40963424 AAACTTACAATCATGGCTTAAGG - Intronic
1149343000 17:55705937-55705959 AAACTTACAACCATGGCTGAAGG - Intergenic
1150508245 17:65720969-65720991 AAACTTAAAAGCATGGATTCTGG - Intronic
1150520081 17:65857213-65857235 AACTTTAAAACCATGGCTTCTGG + Intronic
1150585061 17:66510043-66510065 AAACTAAAAAACATGGCTTCAGG - Intronic
1150609520 17:66722764-66722786 AACCTAAAAATCCTGGATTCTGG + Intronic
1150760351 17:67955816-67955838 AAACAAAAAACTGTAGCTTCAGG + Intronic
1150919547 17:69468779-69468801 AAACTAAAAACCATGATTTCAGG + Intronic
1150998669 17:70348830-70348852 AAACTAAACACCATGGCTTTAGG + Intergenic
1151837378 17:76591329-76591351 AAATTAAAAACCATTGCGGCCGG - Intergenic
1152164747 17:78695336-78695358 AAACTAAACACGAGGACTTCAGG + Intronic
1153033074 18:733481-733503 AACCTAAAAAGCATGGCTTTCGG + Intronic
1153356982 18:4148090-4148112 AAACTAAAAGCCATGGCTTCAGG + Intronic
1154498498 18:14980412-14980434 AAACTAAAAACTGTGGCTTTGGG - Intergenic
1154510951 18:15101348-15101370 AAACTAAAAACTAATGCTTGAGG - Intergenic
1155014901 18:21825089-21825111 AGACTAAAAACCTTTGATTCAGG + Intronic
1156272268 18:35546746-35546768 AAACTAAAAACCATGGCTTCAGG - Intergenic
1157479191 18:48042236-48042258 TAAACAAACACCATGGCTTCAGG + Intronic
1157795367 18:50569658-50569680 AAACTAAAAACCATGGCTTCAGG + Intronic
1157927451 18:51781777-51781799 AAACTAAAAACCATGGCTTTAGG - Intergenic
1158927316 18:62281054-62281076 AAACTAAAAACCCCGGCTTCAGG + Intronic
1159336950 18:67080774-67080796 AAACTAAAACAGATGGCTTCGGG - Intergenic
1159469428 18:68832539-68832561 AAGCTAAAAACCAAGGTTTCCGG - Intronic
1159591381 18:70338864-70338886 GAACCAAATACCATGGCTTTTGG + Intronic
1159654337 18:71014083-71014105 AAACAAAAAAGAATGGCTACTGG - Intergenic
1160234036 18:77071473-77071495 AAACTAAAAACCATGGCTTCAGG - Intronic
1160339136 18:78071546-78071568 TAACGACAAACCATGGCTTTGGG + Intergenic
1160597818 18:79989107-79989129 AAATTAAAAAACCTGGTTTCAGG - Intronic
1162122721 19:8481687-8481709 AACTTAAAAACCATGGTTTCAGG + Intronic
1162171758 19:8795290-8795312 AAACTAGAAACCATGGATTCAGG + Intergenic
1162293506 19:9796668-9796690 AAACTAAAAACCATGGCTTCAGG - Intergenic
1162471547 19:10875029-10875051 AAAAAAAAAAGCATGGGTTCTGG + Intronic
1164122629 19:22281764-22281786 AAAGTAAAAACAAGGACTTCAGG - Intergenic
1164568991 19:29355202-29355224 AAACTTAAAATCATGGCGTAAGG - Intergenic
1164914382 19:32038880-32038902 ATGCTAAAAACCATTGCTTCAGG - Intergenic
1165976003 19:39677396-39677418 AAACCAAAAACCATTTATTCAGG - Intergenic
1166158722 19:40935800-40935822 AATCTGAAAACCATGGCTTCAGG - Intergenic
1166167650 19:41003704-41003726 AAACTGAAAACCATGGCTTCAGG - Intronic
1167461698 19:49628155-49628177 AAACTAAAAACCATGGCTTCAGG + Intergenic
1168399758 19:56078590-56078612 AAACTAAAATCCATGATTTCAGG + Intergenic
1168566313 19:57427144-57427166 AGAAACAAAACCATGGCTTCAGG - Intronic
926358610 2:12064322-12064344 GAAATAAACACCAGGGCTTCGGG - Intergenic
926802555 2:16671938-16671960 AAACTTACAACCATGGCTGAAGG + Intergenic
926969354 2:18451575-18451597 AAACTATAAATTCTGGCTTCAGG + Intergenic
927015463 2:18955443-18955465 AAACTAGAAACCATTGCTCAAGG - Intergenic
927584319 2:24285582-24285604 AAACTAAAAACCCAGGCTCATGG - Intronic
928056290 2:28058492-28058514 AAACTTAATATCAAGGCTTCAGG + Intronic
928615712 2:33037701-33037723 AAAATAAAAACTATATCTTCAGG - Intronic
929284586 2:40121046-40121068 AAACTAAAAACCATGGCTTCAGG - Intronic
929373102 2:41250607-41250629 AAAGTAAAATTCATAGCTTCTGG + Intergenic
930112321 2:47689111-47689133 AAACTAAAAACCATGGCTTCAGG - Intergenic
930455360 2:51601660-51601682 GAACTATAAACCATGGCTCGAGG - Intergenic
930564709 2:53004809-53004831 AAACTAAAACCAAAAGCTTCAGG + Intergenic
930735678 2:54776169-54776191 AAACTAAAAAACATGGCTTTGGG - Intronic
932162764 2:69477361-69477383 AAACTCAAAACCGGGGCTTGGGG + Intronic
932909554 2:75791490-75791512 AAACAAAAAACCATAGTTACTGG - Intergenic
933262151 2:80142718-80142740 AAACTAAAAACCATGGCTTTGGG - Intronic
934952558 2:98587688-98587710 AAAATAAAAACCAATCCTTCAGG - Exonic
934987289 2:98896785-98896807 AAACTAAAAACCATGGCTTCAGG - Intronic
935609624 2:105007769-105007791 AAACTAAAAACCATGGCTTCAGG - Intergenic
935917696 2:107973840-107973862 AAAGTAAAAATCACGGCTTTAGG - Intergenic
936701414 2:115015817-115015839 AAACTACAAACCATTGCTCAAGG + Intronic
936749966 2:115630078-115630100 AAACTACAAACCATGGCTCAAGG - Intronic
936888752 2:117344046-117344068 AAACTTAAAATCATGGCTGAAGG - Intergenic
937723656 2:125133284-125133306 GAACTACAAACCATGGCTCAAGG + Intergenic
938506161 2:131885810-131885832 AAACTAAAAACTAATGCTTGAGG - Intergenic
939423270 2:142001238-142001260 AGAATAAAAACCATGGCTTTTGG - Intronic
939441191 2:142252339-142252361 AAGCTAAAATCCTTGGCTTTTGG + Intergenic
941406679 2:165098611-165098633 AAACTAAAAACCATGGCTTCAGG + Intronic
941478910 2:165982117-165982139 AAACTAAAAGTCATGGCTTCAGG - Intergenic
941494332 2:166181503-166181525 AACCTAACAACCATGGGTTAGGG + Intergenic
942895767 2:181052375-181052397 AAACTAAAACCCATGGCTTTAGG + Intronic
943174281 2:184449709-184449731 ATACTCAAATCCATAGCTTCAGG + Intergenic
943359057 2:186896060-186896082 AAACACAAAACTAAGGCTTCAGG - Intergenic
943693307 2:190892527-190892549 AAGCTAAAAACTATAGCTTTTGG - Intronic
944024435 2:195146205-195146227 AAACTTAAAACCATGGCTGAAGG - Intergenic
944178956 2:196865940-196865962 AAACTACAAACCACTGCTTAGGG + Intronic
944239518 2:197472393-197472415 AAACTAAAACCCATGGCTTCAGG + Intronic
944822142 2:203441495-203441517 AAACTAAAAAGCAGGGAGTCTGG + Exonic
945039068 2:205729248-205729270 CATCTGAAAACCATGGCTTCTGG + Intronic
945998747 2:216463034-216463056 AAACTAATAACCATGGATGGAGG - Intronic
947154614 2:227149460-227149482 AAACTAAAAATCATGGTTTCAGG + Intronic
948613200 2:239182452-239182474 AAAGCAACAACCATGGCTGCTGG + Intronic
1169031013 20:2406857-2406879 AAAAAAAAAACCATGGCCACAGG + Intronic
1170941532 20:20852415-20852437 AAACTTAAAACCATGGCAGAAGG + Intergenic
1172736350 20:37128748-37128770 AAACTAAATACCATGGCTTCAGG + Intronic
1173037249 20:39424338-39424360 AAACTAAAAACCATGGCTTCAGG - Intergenic
1173909436 20:46653470-46653492 AAACTAAAAACCATGGCTTCAGG + Intronic
1174157758 20:48527878-48527900 AAACAAAGACCCCTGGCTTCAGG + Intergenic
1174236073 20:49093157-49093179 AGACCAGAAAACATGGCTTCCGG + Intronic
1174432404 20:50479755-50479777 ACAGTAACTACCATGGCTTCTGG + Intergenic
1174740962 20:53013940-53013962 AAAGTAAACTCCATGGCTGCAGG - Intronic
1174914921 20:54644148-54644170 AAACCTGAAGCCATGGCTTCTGG - Intronic
1176340970 21:5695707-5695729 AACCCAAAAACCATTGCTGCAGG + Intergenic
1176473224 21:7127860-7127882 AACCCAAAAACCATTGCTGCAGG + Intergenic
1176503857 21:7628749-7628771 AACCCAAAAACCATTGCTGCAGG - Intergenic
1177489953 21:21810075-21810097 AAAATAAAAACAATGTCTTCAGG - Intergenic
1177986069 21:27976568-27976590 AAACTAAAAACTAATGCTTGAGG + Intergenic
1179129455 21:38621668-38621690 AAAATAAAACCCATCTCTTCTGG + Intronic
1179440015 21:41386948-41386970 AAACCAAAAACCATGGCTTCAGG + Intronic
1181691975 22:24568117-24568139 AAAATAAAAACCAAGGCTCAGGG + Exonic
1183166510 22:36151386-36151408 AAACTCAAACCCATGTCCTCAGG + Intronic
1203240236 22_KI270733v1_random:10165-10187 AACCCAAAAACCATTGCTGCAGG + Intergenic
950358829 3:12435851-12435873 AAATTAAAAACCATGGCTTCAGG + Intergenic
950560559 3:13719013-13719035 AAAATAATAATCATGGCTTTGGG - Intergenic
951398762 3:22203852-22203874 CAACTTCAAACCATGGCTTCTGG + Intronic
951990141 3:28667617-28667639 AAACTAAAAACAATGGCTACAGG + Intergenic
952064493 3:29552131-29552153 ATACAACAAACCATGGCTTTTGG + Intronic
952227844 3:31397298-31397320 AAACTAAATATCATGGGTTGGGG - Intergenic
952606153 3:35149164-35149186 AAACTAAAAATTGTGGCTTCAGG + Intergenic
952798341 3:37263350-37263372 AAACTAAAAACCATGCCTTTAGG - Intronic
953313930 3:41908421-41908443 AAGCTCAAAACCATGGATCCAGG - Intronic
955191414 3:56765256-56765278 AAACTAAAAACCATGGCTTCAGG - Intronic
955410589 3:58653053-58653075 AAAATAAAATCCTTGTCTTCAGG + Intronic
955990215 3:64618833-64618855 ACACAAAAACTCATGGCTTCGGG + Intronic
956043043 3:65166729-65166751 AAACTAATCACTATGGCTCCAGG - Intergenic
956291174 3:67661934-67661956 AAGCTAAGAACCATGGCCTGTGG - Intergenic
957190666 3:77005005-77005027 AAACGAAAAACCATGGCTTCGGG + Intronic
957281784 3:78160225-78160247 AAACCAAAAAAAATGGCTTCAGG - Intergenic
957944372 3:87043892-87043914 AAACTAAAAACAATGGCTTCAGG - Intergenic
959015827 3:101132925-101132947 AAGCTAAAAACCATGGCTTCAGG + Intergenic
959376344 3:105593145-105593167 TAACTAAAGACCATGGGTGCTGG - Intergenic
959550618 3:107651897-107651919 AAACTAAAAACCATGGCTACAGG - Intronic
960733079 3:120747194-120747216 AAAATAAAAACCTGGGCTTCGGG - Intronic
960740755 3:120830855-120830877 AAACTGAAAACGGTCGCTTCAGG + Intergenic
960811345 3:121630481-121630503 AAACTAAAAACCATGGCTTCAGG - Intergenic
961959560 3:130840444-130840466 GAACTATAAACAAAGGCTTCTGG + Intergenic
962339074 3:134566436-134566458 AGATTAAAAACCATAGCTTTAGG + Intronic
964106879 3:153049148-153049170 AAAATAAAAACCATGGAATGTGG - Intergenic
965128893 3:164669176-164669198 AAACTACAAACCATGGCTCAAGG + Intergenic
965219643 3:165912230-165912252 AAACCAAAAATCTTGGCTTCTGG - Intergenic
965224948 3:165976207-165976229 AAACAAAAAGCTATGGCTTTTGG - Intergenic
965459990 3:168950646-168950668 AAATTAGAAACCAAGGCTTTTGG - Intergenic
965511353 3:169571309-169571331 GAACTAAAAACCATTGCTCAAGG + Intronic
965810814 3:172590115-172590137 AAACTTAAAACCATGGCAGAAGG - Intergenic
966041450 3:175494604-175494626 TAACGAAAAAGCATGGATTCTGG - Intronic
967540534 3:190662084-190662106 ATAATAATAACCATAGCTTCTGG + Intergenic
967562297 3:190930750-190930772 AAGCTAAAAACCATGACTTTTGG - Intergenic
967692164 3:192488095-192488117 TAACTATAAGCTATGGCTTCTGG + Intronic
968507989 4:980798-980820 AAACTAAAAACCAGGGTTTAGGG + Intronic
969069362 4:4522079-4522101 AAAATAAAAACCATGTCTAAAGG - Intronic
969762773 4:9201669-9201691 TAACTGAATACCATGGCTTCTGG - Intergenic
969778604 4:9378982-9379004 CAGCTAAATACCATGGCTTCTGG - Intergenic
970761237 4:19490812-19490834 AAAATAAAAACCATAGCTTCAGG + Intergenic
970837435 4:20427191-20427213 AAACTAAAAGCTATTGGTTCAGG - Intronic
971435134 4:26613379-26613401 AAACCAAAAACCATGGCTTCAGG - Intronic
972227369 4:37028858-37028880 CAACTACAAACCATTGCTTAGGG + Intergenic
973687438 4:53386855-53386877 AAACTAAAAACCATGGCTTTGGG - Intronic
973949334 4:55995353-55995375 AGACTAAAAACCATGGCTTCAGG - Intronic
974531853 4:63118268-63118290 GAACTAAAAAACACTGCTTCAGG - Intergenic
974858860 4:67495486-67495508 AAACTAAAAAGCATGGTTTCAGG - Intronic
975599555 4:76085211-76085233 GAACCAAAAACCATCGCTGCTGG + Intronic
975912339 4:79281837-79281859 AAACTAAACACCATGGCTGCAGG + Intronic
976067676 4:81207848-81207870 AGACTTGAAACCTTGGCTTCAGG - Intronic
976659101 4:87520608-87520630 AAACTAAACAAAAGGGCTTCAGG - Intronic
976689183 4:87850281-87850303 AAAGTCTAAACCATAGCTTCAGG - Intergenic
976756668 4:88505980-88506002 AAATGAAAAACCATGGCTTCAGG - Exonic
976944017 4:90742021-90742043 AAACTTAAAATCATGGCATAAGG + Intronic
977529809 4:98186928-98186950 AAAAAAAAAACTATGGCTTAGGG + Intergenic
978244802 4:106559763-106559785 AAACTACAAACCACTGCTCCAGG - Intergenic
978334129 4:107647622-107647644 AAACAAAAGACCATGCTTTCAGG - Intronic
979001069 4:115220558-115220580 AAATGAAAAACCGTGACTTCAGG - Intergenic
979697899 4:123634943-123634965 GAACTACAAACCACGGCTTAAGG - Intergenic
980843725 4:138298901-138298923 AGAGTAAGAACAATGGCTTCAGG - Intergenic
980964162 4:139504272-139504294 AAATTCAAAACCCTGGCTTTTGG + Intronic
981200246 4:141971973-141971995 AAACTTAAAATCATGGCTGAAGG + Intergenic
981499074 4:145428067-145428089 AAACAGAAAACCATGGCTTCAGG - Intergenic
982246005 4:153351635-153351657 AAAGTGAAAAGCATGGATTCTGG + Intronic
983535493 4:168852740-168852762 AATCTAATTACCATGGCTTAAGG - Intronic
984008093 4:174338188-174338210 AAAACAAAAAACATGGCTTAGGG - Intergenic
984331178 4:178321097-178321119 AAACTAAAAACCATGGCTTCAGG - Intergenic
984968497 4:185164637-185164659 AAACTAAAAACCATGGCTTCAGG + Intronic
985732480 5:1556979-1557001 AAACTGAAGACCATGGCCACAGG - Intergenic
985763104 5:1761732-1761754 ACACTAAAAGCCATTGCCTCTGG - Intergenic
986287940 5:6373964-6373986 AAACAAAGAACCATGACTACAGG + Intronic
986996905 5:13617735-13617757 AAACTACAAACCACTGCTTAAGG + Intergenic
987903094 5:24038871-24038893 AAACTACAAACCATGGCTCATGG - Intronic
988059893 5:26152978-26153000 AAACTACAAACCATTGCTCAAGG + Intergenic
988082491 5:26431524-26431546 AAACTAACATCCATAGCTTTAGG + Intergenic
988315571 5:29622429-29622451 AAACTAAAAACCCATTCTTCAGG + Intergenic
989059391 5:37395373-37395395 AAACTAAAAACCACGGCTTCAGG - Intronic
989823969 5:45831335-45831357 AAACTCAAACCCAAGACTTCAGG - Intergenic
990550748 5:56875660-56875682 AGACTAAAAACCATGGCTTCAGG + Intronic
990805454 5:59655640-59655662 AAGCTAAAAACCATGGCTTCTGG - Intronic
991181378 5:63755132-63755154 AAATTAGAGAGCATGGCTTCTGG + Intergenic
991261885 5:64676731-64676753 AAACTAAAAACCATGGCTTCAGG + Intergenic
991596991 5:68316056-68316078 CAACAAAAAGCCATGGGTTCAGG - Intergenic
992422648 5:76622011-76622033 AAACTAAAAACCATGGCTTCAGG + Intronic
994579846 5:101627880-101627902 AAACTTAAAATCATGGCTGAAGG + Intergenic
994694996 5:103062813-103062835 AAACTTAAAACCATGGCAGAAGG - Intergenic
995303361 5:110612238-110612260 AGACTAAAATTCATGTCTTCTGG + Intronic
995346917 5:111132223-111132245 AGACTAAAAACCCTCCCTTCTGG + Intergenic
996417305 5:123224082-123224104 AAACTAACATCCAGGGCTCCTGG + Intergenic
997986865 5:138508624-138508646 AAACTTAAAACCAGGGTCTCAGG - Intronic
998011908 5:138702251-138702273 AAATTTAAAACCCAGGCTTCTGG + Intronic
998299395 5:141003316-141003338 AAACAAAAAACCCTGCCCTCTGG - Intronic
998906785 5:146913627-146913649 AAACCAAGAACCATGTCTTGTGG - Intronic
999292307 5:150434155-150434177 AAACCAAAAACTCTGGCATCAGG - Intergenic
1001383189 5:171317205-171317227 AAAACAAAAACCATGGCATATGG + Intergenic
1001817080 5:174678653-174678675 AAACTAAAAACCATGGCTTCAGG - Intergenic
1002315243 5:178339158-178339180 GAACTAAAACCCATTGCCTCAGG + Intronic
1002450395 5:179315226-179315248 AGATTAAATACCCTGGCTTCTGG + Intronic
1003253060 6:4449404-4449426 AAACTAAAAACCAAGGCGTCAGG - Intergenic
1004493835 6:16144572-16144594 AACCTAAAAGCCAAGACTTCAGG + Intronic
1004658423 6:17687555-17687577 AAAATAAAAACCATTCTTTCAGG + Intronic
1005974236 6:30785154-30785176 ATACTAAAAACCATTTCTGCCGG - Intergenic
1007317775 6:41003231-41003253 AAACAGGAAACCATGGCTGCCGG + Intergenic
1007361186 6:41357388-41357410 AAACTAATAACAATGGTTGCTGG + Intergenic
1008554691 6:52663560-52663582 AAACTAAAAACCACGGCTTCAGG - Intergenic
1008658858 6:53644671-53644693 AAACTTACAACCATGGCTGAAGG - Intergenic
1008793253 6:55265988-55266010 AAACTAAAAACCAGGGCTTCAGG + Intronic
1009192955 6:60651665-60651687 AAACTAAAAACTGTGGCTTCAGG - Intergenic
1009214317 6:60901809-60901831 GAACTAAAAACCACTGCTTAAGG + Intergenic
1010620063 6:78062896-78062918 CAACTATAAGCCATGGCTTGTGG - Intergenic
1010627664 6:78158223-78158245 AAACTAAAACCCATGGCTTCAGG - Intergenic
1010799611 6:80160150-80160172 AAACGAAAAAGCATGACTTAAGG - Intronic
1011020238 6:82804890-82804912 GAACTAAAAACCATTGCTCAAGG - Intergenic
1011333086 6:86232246-86232268 AAACTAGAAAGCATGCCTACAGG - Intergenic
1011767532 6:90639169-90639191 CAACTAAAGTCCATGGATTCAGG - Intergenic
1012557513 6:100533646-100533668 AAAAGAGAAACCATGGCTTATGG - Intronic
1012575722 6:100795198-100795220 AAAAAAAAACCCATTGCTTCTGG + Intronic
1012783716 6:103596080-103596102 AAACTAAAATCAAAGGCTGCAGG + Intergenic
1012819631 6:104069716-104069738 AAACTAGAAACCATGGCTTTAGG - Intergenic
1012859716 6:104544779-104544801 AAATTAAAAACTGTTGCTTCTGG + Intergenic
1013648777 6:112172265-112172287 CATCTCAAAACCATGGGTTCTGG - Intronic
1013986894 6:116205175-116205197 AAACTAAAAACCATGTCTTCAGG + Intronic
1014085198 6:117334313-117334335 AAACTACAAACCATTGCTCAAGG + Intronic
1014176632 6:118338219-118338241 GAACTACAAACCATTGCTCCAGG - Intergenic
1014992255 6:128095453-128095475 AAACTAAAAACCATGGCTTCAGG - Intronic
1015335105 6:132027963-132027985 AAACTAAAATCCATGGCTTCAGG - Intergenic
1015800387 6:137055264-137055286 AAACTAAAAACCATTGCTGAAGG + Intergenic
1016313821 6:142763660-142763682 AAAATAAAAACTTTGGTTTCAGG - Intronic
1016430307 6:143977185-143977207 GAACTCTAAACCATGGATTCTGG - Intronic
1017888416 6:158620088-158620110 AAACTAAACACTTTGGCTTTAGG + Intronic
1018049940 6:160000278-160000300 AAACTTAAAATCATGGCAGCAGG + Intronic
1019206138 6:170363599-170363621 AAAGTAAAAACTGGGGCTTCAGG - Intronic
1019858445 7:3633576-3633598 AAACAAAAAAACATGGCTCTTGG - Intronic
1020481045 7:8661486-8661508 AAAACAAAAAACATGACTTCAGG - Intronic
1020791265 7:12631275-12631297 AAACTATAACCCGTGCCTTCAGG + Intronic
1020974396 7:14987545-14987567 AAACTAAAAACCATGACTTCAGG - Intergenic
1021286680 7:18788919-18788941 AACCTAAAATCCATCTCTTCTGG - Intronic
1021290701 7:18840872-18840894 AATATAAGAATCATGGCTTCCGG + Intronic
1022271697 7:28814061-28814083 GAAATAAAAACCAGGCCTTCTGG - Intronic
1022435840 7:30384160-30384182 AAACTAAAAACCATGGCTTCAGG + Intronic
1022627172 7:32049435-32049457 AAACTAAAAATCATGGCTTCAGG - Intronic
1022728244 7:32999725-32999747 AGACAAAAAACCCTGGCTTTTGG - Intronic
1022780607 7:33578669-33578691 AAAACAAAAACCAAGGTTTCAGG + Intronic
1022816877 7:33922530-33922552 AAACTAAAAACCATGACTTCAGG - Intronic
1023218423 7:37891738-37891760 AAACTAAAAACCATGGTTTTGGG + Intronic
1023706372 7:42945909-42945931 AAAGTGAAAACCATGACTTCAGG - Intronic
1023740547 7:43277409-43277431 AAACGAAAAACCATGGCTTCAGG - Intronic
1024558497 7:50623805-50623827 AATCCAAAAACCAAAGCTTCTGG - Intronic
1024806516 7:53147854-53147876 AAGCTAAAAACCATGTCTGCAGG + Intergenic
1024924396 7:54598074-54598096 AAACTAAAAACCATGGCTTCAGG + Intergenic
1025045410 7:55688293-55688315 AAACAAAAAACCCTGGCTTTTGG + Intergenic
1025121366 7:56306802-56306824 AAACTAAAAATCATGGCTTCAGG - Intergenic
1025713044 7:63929278-63929300 AAACCAAATTACATGGCTTCAGG - Intergenic
1026496199 7:70905818-70905840 AATAAAAAAACCATGGCTTTTGG - Intergenic
1026793507 7:73350636-73350658 AGACTAAAAACAATGTTTTCTGG + Intronic
1027954920 7:84865572-84865594 AAACTAAAAATCATAGCTTTGGG - Intergenic
1028114260 7:86979934-86979956 AAACTAAAAATCATGGTTTCAGG + Intronic
1029387621 7:100253992-100254014 AAAAAAAAAAGCATGGCTGCAGG - Intronic
1029630479 7:101747267-101747289 AAACTAAAAACCATGGTTTCAGG + Intergenic
1030237215 7:107277400-107277422 AAACTAAAAACCATGGCTTCAGG + Intronic
1030289970 7:107862546-107862568 AAACTCAAAATCATGGATTCAGG - Intergenic
1031989546 7:128188760-128188782 AGGTTAAAAACCATGGCTTTAGG + Intergenic
1032495964 7:132362717-132362739 AGACTATAAACCATGACTTTGGG + Intronic
1032578284 7:133078941-133078963 AAGCTAAAAACAATGGCTTATGG + Intronic
1032738721 7:134717212-134717234 GAACTAAAATCCATGGTTTAGGG + Intergenic
1033683400 7:143618682-143618704 AAACTAAAAACCGTGAGTTCAGG - Intergenic
1033701213 7:143838956-143838978 AAACTAAAAACCGTGAGTTCAGG + Intergenic
1034480801 7:151319206-151319228 AAACTAAAAACCATGGCTTCAGG + Intergenic
1035011312 7:155717841-155717863 AAACTAAAAGCCTTGGCATAGGG + Intronic
1035853375 8:2944567-2944589 AAAACAAAATCCCTGGCTTCAGG - Intronic
1036272866 8:7323404-7323426 TAATTGAATACCATGGCTTCTGG - Intergenic
1036276049 8:7352955-7352977 CAGCTAAATACCATGGCTTCTGG - Intergenic
1036345301 8:7957392-7957414 CAGCTAAATACCACGGCTTCTGG + Intergenic
1036348484 8:7986944-7986966 TAATTGAATACCATGGCTTCTGG + Intergenic
1036397600 8:8382266-8382288 CAAATAAAAACAATGGCTTTTGG + Intronic
1036840630 8:12118159-12118181 CAGCTAAATACCATGGCTTCTGG + Intergenic
1036843754 8:12147409-12147431 TAATTGAATACCATGGCTTCTGG + Intergenic
1036862433 8:12364404-12364426 CAGCTAAATACCACGGCTTCTGG + Intergenic
1036865126 8:12389727-12389749 TAATTGAATACCATGGCTTCTGG + Intergenic
1037329413 8:17729273-17729295 ATACTCAAAACCGTGGCTGCAGG + Intronic
1037365147 8:18114339-18114361 AAACTACAAAACACTGCTTCAGG - Intergenic
1037660698 8:20924176-20924198 AAATTAAAAACGATGACCTCAGG - Intergenic
1038356808 8:26836984-26837006 AAACCAAAACCCTTGGATTCTGG - Intronic
1038393615 8:27229983-27230005 AAATTAAAAACCTTGGTTTAGGG + Intergenic
1038626429 8:29197715-29197737 AAACTAAAGACCATGGCTTCAGG + Intronic
1038781988 8:30575827-30575849 AAAGTAAAACCCGTGGCTACAGG + Intergenic
1039600524 8:38833204-38833226 AAACTAAAAACTATGGCTTCAGG - Intronic
1040487030 8:47883449-47883471 AAACTCAAAGCCTTTGCTTCTGG + Intronic
1041240068 8:55841787-55841809 AAAAAAAAAATCATGGCTTTGGG - Intergenic
1041338914 8:56821172-56821194 AAATTAAAAATCATGTATTCAGG - Intergenic
1041572506 8:59353209-59353231 AAACTAAAAACCATGGCTTCGGG - Intergenic
1041978537 8:63828245-63828267 AAACTAAAAACCATGGCATCAGG - Intergenic
1042199231 8:66264306-66264328 AAACTGAAAACCATGGTTTCAGG - Intergenic
1042708769 8:71691533-71691555 AAACTAAAAATCTTGGCTTGAGG + Intergenic
1043271793 8:78343399-78343421 AAGCAAAAATCCATTGCTTCTGG + Intergenic
1043379562 8:79688035-79688057 AAACTATAAACCATGGCTTCAGG + Intergenic
1043450899 8:80365340-80365362 AAACAAAAAAACATGAGTTCAGG + Intergenic
1044003023 8:86908392-86908414 AAACACAAAACCAAGTCTTCTGG - Intronic
1044170239 8:89042474-89042496 AAACTAAAAACCAAGGCTTCAGG - Intergenic
1044576036 8:93769773-93769795 AAACTAATAAACATGTATTCTGG - Intronic
1045601352 8:103721194-103721216 AAACATATAAACATGGCTTCAGG - Intronic
1045728324 8:105202335-105202357 AAACTATAAACCACTGCTTAAGG + Intronic
1047085924 8:121515047-121515069 AAACTAAAACCCACAGTTTCAGG + Intergenic
1047393378 8:124472548-124472570 AAACTAAAAACCATGGCTTCAGG + Intergenic
1048862026 8:138730631-138730653 TGTATAAAAACCATGGCTTCCGG + Intronic
1049293243 8:141815130-141815152 AAACAAAAAAGCATGGCAACAGG - Intergenic
1050588804 9:7141287-7141309 AAACTAAAAAGGATGGCTTCAGG + Intergenic
1051370967 9:16358723-16358745 AAACTAAAAACCATGGCTTCAGG + Intergenic
1051376997 9:16412197-16412219 AATCTAAAAAAGATGGCGTCAGG - Exonic
1051493569 9:17694249-17694271 AAACTTAAAACCATGGCAGAAGG + Intronic
1052049922 9:23833348-23833370 AAAATAAAAATCATAGCTTAAGG - Intergenic
1052329818 9:27256029-27256051 AAACTACAAACCACTGCTTAAGG + Intergenic
1053118529 9:35526865-35526887 AAACAAGAATCCATGGATTCAGG - Intronic
1053521997 9:38789983-38790005 AAAATAAAAATCCTGGTTTCTGG + Intergenic
1053608693 9:39687317-39687339 AAACTAAAAACCATGGCTTCAGG + Intergenic
1053866542 9:42443675-42443697 AAACTAAAAACCATGGCTTCAGG + Intergenic
1054194162 9:62013972-62013994 AAAATAAAAATCCTGGTTTCTGG + Intergenic
1054244831 9:62655093-62655115 AAACTAAAAACCATGGCTTCAGG - Intergenic
1054558957 9:66689624-66689646 AAACTAAAAACCATGGCTTCAGG - Intergenic
1054644245 9:67574719-67574741 AAAATAAAAATCCTGGTTTCTGG - Intergenic
1054936260 9:70691969-70691991 AAACTAAAATCCATGGCTTTAGG + Intronic
1055078882 9:72246980-72247002 AAACTAAAAACCATGGCTTCAGG + Intronic
1057109930 9:92459657-92459679 AAACTAAAAAAAATCCCTTCAGG - Exonic
1058149634 9:101449701-101449723 AACATAAAAACCATGTCTCCAGG + Intergenic
1058525283 9:105851028-105851050 AAACTTAAAACCATGGCGCAAGG - Intergenic
1058624768 9:106923664-106923686 ATATTAAGAACCATGGCTACAGG - Intronic
1059814418 9:117895693-117895715 AAACTAAAACCCTAGGCATCTGG + Intergenic
1059975041 9:119707164-119707186 AAACTACAAAATATGCCTTCTGG - Intergenic
1060278590 9:122200546-122200568 AAACTAAAAACCATGGCTTCAGG + Intergenic
1060433741 9:123574732-123574754 AAACTAAAAGCTATGGCTTTGGG + Intronic
1060726529 9:126009625-126009647 AAACTAACAATCATGGCTGAAGG + Intergenic
1061352119 9:130073723-130073745 AAACAAAAAACCCAGGCCTCTGG - Intronic
1203422097 Un_GL000195v1:2286-2308 AACCCAAAAACCATTGCTGCAGG - Intergenic
1185913537 X:4008978-4009000 AAACTAAAATCCATGGCTTCAGG - Intergenic
1186160313 X:6770462-6770484 AACAAAAAAACCAAGGCTTCTGG - Intergenic
1186555656 X:10555765-10555787 AAAATAAAAACCATATTTTCCGG + Intronic
1186566735 X:10671258-10671280 AGAATTAAAACCATGGATTCTGG + Intronic
1186708893 X:12172220-12172242 AAACTAAAAATCATGGCTTCAGG - Intronic
1187009900 X:15268346-15268368 AAACAAAACACCCTGACTTCAGG + Intronic
1187178991 X:16925255-16925277 AAAAAAAAAACTATGGTTTCTGG - Intergenic
1187187219 X:16998363-16998385 AAACTAACAAAATTGGCTTCTGG - Intronic
1187266865 X:17741696-17741718 AAACTAAAAAGCATAGCTTCAGG - Intronic
1187992424 X:24889237-24889259 CAACTAGAAAGCATGGCATCTGG + Intronic
1188078338 X:25806447-25806469 AAACAAAGAAACATGGCTACAGG - Intergenic
1188739980 X:33766403-33766425 AATTTAAACACCATGACTTCAGG + Intergenic
1188750948 X:33905246-33905268 AAACTTAAAATCATGGCATAAGG - Intergenic
1189141968 X:38616572-38616594 AACTTAAAAACCATGGCTTCAGG + Intronic
1190716848 X:53111784-53111806 AAACTAAAAACCGTGGCTTCAGG + Intergenic
1191911024 X:66150051-66150073 AAACAAAAAAACTTGGTTTCAGG - Intergenic
1193209728 X:78792338-78792360 GAACTAAAAACCACGGCTCAAGG + Intergenic
1193726530 X:85046452-85046474 AAACTGACAACCATGCCTGCAGG + Exonic
1194630969 X:96283199-96283221 AAACTAAAAAAAATGAATTCAGG + Intergenic
1194686901 X:96931044-96931066 AAACAAAAACACATCGCTTCTGG - Intronic
1194855012 X:98917729-98917751 AAACTTAAAATCATGGCAGCAGG - Intergenic
1195397010 X:104422035-104422057 AAACTTGAACCCATGGGTTCAGG - Intergenic
1196397503 X:115280839-115280861 AAACTAAAAACTATGTCTTGAGG - Intergenic
1196477936 X:116111160-116111182 AAATTAAAAATCACGACTTCTGG - Intergenic
1196560737 X:117145038-117145060 GAACTACAAACCATTGCTTGAGG - Intergenic
1196969780 X:121096269-121096291 AATCTGCATACCATGGCTTCTGG + Intergenic
1197666496 X:129229855-129229877 AAACTAGAAACTCAGGCTTCTGG + Intergenic
1197810410 X:130436787-130436809 ACACTAACATTCATGGCTTCTGG + Intergenic
1200498743 Y:3918629-3918651 GAACTAAAAACCACTGCTTAAGG - Intergenic
1201331217 Y:12823523-12823545 AACTAAAAACCCATGGCTTCAGG - Intronic
1201677776 Y:16606541-16606563 AAACAAAAAATCATGATTTCTGG + Intergenic
1201766165 Y:17575425-17575447 AAACAAAAAACAATGCCGTCAGG + Intergenic
1201835387 Y:18330564-18330586 AAACAAAAAACAATGCCGTCAGG - Intergenic