ID: 1067605765

View in Genome Browser
Species Human (GRCh38)
Location 10:47661106-47661128
Sequence CAGACAGAAACTAAAAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 4, 1: 66, 2: 70, 3: 61, 4: 495}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067605765_1067605767 -5 Left 1067605765 10:47661106-47661128 CCATGGTTTTTAGTTTCTGTCTG 0: 4
1: 66
2: 70
3: 61
4: 495
Right 1067605767 10:47661124-47661146 GTCTGTAGTGATAAGTGGAAAGG No data
1067605765_1067605766 -10 Left 1067605765 10:47661106-47661128 CCATGGTTTTTAGTTTCTGTCTG 0: 4
1: 66
2: 70
3: 61
4: 495
Right 1067605766 10:47661119-47661141 TTTCTGTCTGTAGTGATAAGTGG No data
1067605765_1067605770 5 Left 1067605765 10:47661106-47661128 CCATGGTTTTTAGTTTCTGTCTG 0: 4
1: 66
2: 70
3: 61
4: 495
Right 1067605770 10:47661134-47661156 ATAAGTGGAAAGGAGGGATGAGG No data
1067605765_1067605769 -1 Left 1067605765 10:47661106-47661128 CCATGGTTTTTAGTTTCTGTCTG 0: 4
1: 66
2: 70
3: 61
4: 495
Right 1067605769 10:47661128-47661150 GTAGTGATAAGTGGAAAGGAGGG No data
1067605765_1067605771 9 Left 1067605765 10:47661106-47661128 CCATGGTTTTTAGTTTCTGTCTG 0: 4
1: 66
2: 70
3: 61
4: 495
Right 1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG No data
1067605765_1067605774 20 Left 1067605765 10:47661106-47661128 CCATGGTTTTTAGTTTCTGTCTG 0: 4
1: 66
2: 70
3: 61
4: 495
Right 1067605774 10:47661149-47661171 GGATGAGGAAGGGGCTTTACTGG 0: 51
1: 55
2: 49
3: 49
4: 226
1067605765_1067605773 11 Left 1067605765 10:47661106-47661128 CCATGGTTTTTAGTTTCTGTCTG 0: 4
1: 66
2: 70
3: 61
4: 495
Right 1067605773 10:47661140-47661162 GGAAAGGAGGGATGAGGAAGGGG No data
1067605765_1067605768 -2 Left 1067605765 10:47661106-47661128 CCATGGTTTTTAGTTTCTGTCTG 0: 4
1: 66
2: 70
3: 61
4: 495
Right 1067605768 10:47661127-47661149 TGTAGTGATAAGTGGAAAGGAGG No data
1067605765_1067605772 10 Left 1067605765 10:47661106-47661128 CCATGGTTTTTAGTTTCTGTCTG 0: 4
1: 66
2: 70
3: 61
4: 495
Right 1067605772 10:47661139-47661161 TGGAAAGGAGGGATGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067605765 Original CRISPR CAGACAGAAACTAAAAACCA TGG (reversed) Intergenic
900270717 1:1786460-1786482 CAGACAGAAAATTAAAAACCAGG + Exonic
900860526 1:5226159-5226181 CAGAGAAAAATTACAAACCAAGG + Intergenic
901531885 1:9858990-9859012 CAGAATGGAACTAAGAACCAGGG + Intronic
901955055 1:12778071-12778093 CAGAGAGAAATTAAAAAAAAAGG - Intergenic
902549557 1:17211194-17211216 AAAACAAAAACAAAAAACCAGGG - Intronic
902730855 1:18367932-18367954 CATACAGAAACTAAAAATAAAGG + Intronic
903404787 1:23087266-23087288 CATACAGAAACTAAAAAACAAGG + Exonic
904047387 1:27616731-27616753 CAGACGGAAACCAGAACCCAAGG - Intronic
905210505 1:36370788-36370810 CTGACAGATACCAAAATCCAAGG + Intronic
906754929 1:48302638-48302660 AAGGCAGAAAGTAAAATCCAGGG - Intronic
906844344 1:49175024-49175046 CAAAAAGAAACCAAAAATCATGG + Intronic
908515953 1:64892991-64893013 GAGACAGACACTGAGAACCATGG + Intronic
908865047 1:68538373-68538395 CATACAGAAAATAAACACAATGG - Intergenic
909700983 1:78522639-78522661 GAGACAGAAACTGAAAACCATGG - Intronic
909731256 1:78893276-78893298 AAGATAGAAACTAAAAATCATGG + Intronic
909774414 1:79465814-79465836 TAGAAAGAAACTGCAAACCAAGG - Intergenic
910016444 1:82530854-82530876 CAAACAGAAAATAAATACCTAGG - Intergenic
910254295 1:85231910-85231932 CAAACAAAAACAAAAAACAATGG - Intergenic
910256467 1:85253090-85253112 GAGACAGAAACTAAAAACCATGG - Intronic
910655310 1:89612420-89612442 CACATAGAAAATAAAAACAAGGG - Intergenic
911044757 1:93619250-93619272 GAGACAGAAACTAAAAACCATGG - Intronic
911423564 1:97677652-97677674 CAGACAGATACTAATGACAATGG + Intronic
911447439 1:98015254-98015276 CAGATAGAAACCAGAAAACATGG - Intergenic
911485810 1:98503672-98503694 CAGATAAAAAATAAAAAGCAAGG - Intergenic
911665473 1:100546537-100546559 AAAACAAAAACAAAAAACCATGG + Intergenic
911705892 1:101012310-101012332 GAGACAGAAACTAAAAACCATGG - Intronic
912037468 1:105337100-105337122 CATACAGAAACAAAAAGCCAAGG - Intergenic
912296087 1:108472300-108472322 CAGATCTAAACCAAAAACCAAGG - Intergenic
912328043 1:108787439-108787461 GAGACAGAAACTAAAAACCATGG + Intronic
913175057 1:116266001-116266023 GAGACAGAAACTAAAAACCATGG - Intergenic
913186885 1:116376569-116376591 CAGAAAGAACCTAAGAAGCAGGG - Intronic
913379638 1:118195172-118195194 CAGAAAGAAAGAAAGAACCATGG - Intergenic
914292401 1:146286122-146286144 CAGATAGAAAATAAAAAATATGG - Intergenic
914553445 1:148736905-148736927 CAGATAGAAAATAAAAAATATGG - Intergenic
915860068 1:159434701-159434723 CAGATAGGAAACAAAAACCAGGG - Intergenic
916271717 1:162950172-162950194 CAGAAAGTGACTAAAAATCATGG - Intergenic
916683403 1:167124068-167124090 AAAACAAAAACAAAAAACCATGG - Intronic
916894159 1:169144219-169144241 AAGACAAAAATAAAAAACCAAGG + Intronic
918026353 1:180752523-180752545 CATATAGAAAATAAAAATCAGGG - Intronic
918201214 1:182268820-182268842 CTGACAGAAACTGACAGCCAGGG - Intergenic
919008812 1:191932800-191932822 CACACAGAAACTGAAAATAAAGG + Intergenic
919442713 1:197657407-197657429 CAGACAGAAAATTACAACCTGGG - Intronic
920050185 1:203159835-203159857 AAGACAGCAACTAAATACCTAGG + Intronic
920817479 1:209348505-209348527 GAGGCAGAAACTAAAAGCCATGG - Intergenic
921139506 1:212293019-212293041 GAGACAGAAACTAAAAACCATGG + Intronic
921149665 1:212389690-212389712 GAAACAGAAACTAATAACAATGG + Intronic
921415786 1:214885040-214885062 AAGACAGTAAGTAAATACCAGGG + Intergenic
921435524 1:215115668-215115690 CAGAAAGAAACCAAAAGGCAAGG - Intronic
921512660 1:216051223-216051245 CAGATAGAAACCCAGAACCAGGG - Intronic
921607618 1:217173909-217173931 CTGACAGCTACTAAAAAACAAGG + Intergenic
921772135 1:219052968-219052990 TAGACAGAAATAAAAAACAAAGG + Intergenic
923412348 1:233722943-233722965 TAGACAGAAACCAAGAACCATGG + Intergenic
923699655 1:236287805-236287827 GAGACAGAAACTAAAAACCATGG + Intergenic
924061773 1:240182471-240182493 AAGAAAGAAACAAAGAACCATGG + Intronic
924268662 1:242309271-242309293 GAGACAGAAATTAAAAACCATGG + Intronic
924423854 1:243933119-243933141 CACACTGCCACTAAAAACCAGGG + Intergenic
924876756 1:248114435-248114457 CAGAAAAAAATTAAAAACCCTGG - Intergenic
924880007 1:248150827-248150849 CAGAATGAAAAAAAAAACCAAGG - Intergenic
1063220127 10:3959602-3959624 TAGGCAGCAACTAAGAACCAAGG + Intergenic
1065124072 10:22556038-22556060 CAGATAAAACCTAAAAACAAAGG - Intronic
1066156682 10:32685428-32685450 GAGACAGAAACTAAAAACCATGG - Intronic
1066638957 10:37536435-37536457 GAGACAGAAACTAAAAACCATGG - Intergenic
1066687078 10:37991593-37991615 GAGACAGAAACTAAAAACCATGG - Intergenic
1066716244 10:38289497-38289519 GAGACAGAAATTAAAAACCATGG - Intergenic
1067175338 10:43942031-43942053 CTGACAGAAATTAAAACCAAAGG + Intergenic
1067488903 10:46679270-46679292 CAGACAGAAACTAAAAACCATGG + Intergenic
1067605765 10:47661106-47661128 CAGACAGAAACTAAAAACCATGG - Intergenic
1067709859 10:48639415-48639437 CCAACAGAAAGTAAAAGCCAAGG + Intronic
1067745481 10:48932666-48932688 GAGAGAGAAAAAAAAAACCAAGG + Intronic
1067843003 10:49696889-49696911 CAGATAAAAACTTAAAATCAGGG + Intronic
1068044423 10:51867970-51867992 CAGACAAAACCCAAAACCCAAGG - Intronic
1068185603 10:53581693-53581715 CAAAAACAATCTAAAAACCATGG - Intergenic
1068463318 10:57355188-57355210 GAGGCAGAAACTAAAAACCATGG - Intergenic
1068735274 10:60407162-60407184 CTGAGAGAAACTCAAAAGCAGGG - Intronic
1069180895 10:65357243-65357265 AATAAAGAAACTAAAACCCATGG + Intergenic
1069340222 10:67401402-67401424 CAGAGAGAAACTACCAAACATGG + Intronic
1069857711 10:71450858-71450880 CAGACAGAAAATATAAAGCTAGG - Intronic
1070045423 10:72829785-72829807 CAAACAAAAAACAAAAACCAAGG - Intronic
1070707333 10:78649873-78649895 CAGAAACAAACCAAAAGCCAAGG - Intergenic
1070940386 10:80340126-80340148 AAGAGCGAAACTAATAACCAGGG + Intronic
1071024008 10:81091263-81091285 AAAACAAAAACAAAAAACCAAGG - Intergenic
1071025666 10:81110045-81110067 CAGAAAGAAGCTCAAAACTATGG + Intergenic
1071076610 10:81761626-81761648 CAGACATAATCTTAAAACCATGG + Intergenic
1071206520 10:83285849-83285871 CAAAAACAAACAAAAAACCATGG + Intergenic
1071351862 10:84754657-84754679 CATTAAGAAACTAAAAAACAAGG - Intergenic
1071585593 10:86817724-86817746 CTGACAGAAAAGAAAAACCCTGG + Intronic
1071621324 10:87122465-87122487 CAGACAGAAACTAAAAACCATGG - Intronic
1071868864 10:89769364-89769386 GAGACAGAAACTAAAAACCATGG + Intronic
1071934076 10:90507278-90507300 GAGACAGAAACGAAAAACCATGG - Intergenic
1072174855 10:92910144-92910166 CAGTGAGAAACAAAAAAACATGG + Intronic
1072218655 10:93309181-93309203 GAGACAGAAACAAACAACCGTGG - Intronic
1073027052 10:100495719-100495741 TAGAGACAAACCAAAAACCATGG - Intronic
1073088988 10:100917221-100917243 TAGAAAGAAAATATAAACCAAGG + Exonic
1073265445 10:102225713-102225735 CAGACTGACAGTAATAACCATGG - Intergenic
1073366203 10:102943686-102943708 TAGACAGAAAATAAAAACAAGGG - Intronic
1073378331 10:103056508-103056530 CTGACAGAAACGAAAATCAACGG - Intronic
1075797781 10:125133470-125133492 AGGCCAGAAACTCAAAACCAGGG + Intronic
1076379370 10:130014638-130014660 AAGCCAGAAGCTGAAAACCAAGG - Intergenic
1076459406 10:130630261-130630283 GAGACAGAAACTAAAAATCATGG - Intergenic
1076502638 10:130949417-130949439 CAGACAAAAACTGACACCCATGG + Intergenic
1078719704 11:13873092-13873114 CAGACAGAAAATACAGACAATGG - Intergenic
1078727883 11:13948078-13948100 GAGACATAAACTAAAAACCATGG + Intergenic
1078906030 11:15688578-15688600 AAAACAACAACTAAAAACCAAGG - Intergenic
1079282487 11:19099908-19099930 GACACAGAAAATAAAAACTATGG + Intergenic
1079816308 11:25063295-25063317 CACACAGATACCAAAATCCATGG - Intronic
1079823164 11:25157571-25157593 CACACAGAGACTAAAAATAAAGG - Intergenic
1079944847 11:26729269-26729291 GAGACAGAAACTAAAAACCATGG + Intergenic
1080394574 11:31877905-31877927 CAGAAAGAAAATAGAAACCGGGG + Intronic
1080743407 11:35086130-35086152 CAGACAGAGAACAAAAAGCAAGG - Intergenic
1081329850 11:41789414-41789436 AAGACAGAAAATAAAAAGGAAGG - Intergenic
1082747987 11:56987626-56987648 GAGACAAAAATTCAAAACCAGGG + Intergenic
1082750960 11:57016795-57016817 GAGACAAAAATTCAAAACCACGG + Intergenic
1082875690 11:57986026-57986048 TAGAAGGAACCTAAAAACCATGG - Intergenic
1084635495 11:70389679-70389701 GAGACAGAAACTCAAAACCATGG + Intergenic
1084723160 11:70922450-70922472 CACACAAATACTGAAAACCAAGG + Intronic
1085207219 11:74742979-74743001 CAGAGAGAAAATAAGAGCCAAGG - Intergenic
1085215186 11:74823917-74823939 CAGACAGCAACAACAAACCCAGG + Intronic
1085726814 11:78961783-78961805 CAGACAGAAAAAAAAAAAAAAGG - Intronic
1085942680 11:81223777-81223799 CAGAAATAAAATAAAATCCATGG - Intergenic
1086310642 11:85532789-85532811 CTGATAGAAATTAAAAACCAGGG - Intronic
1087109169 11:94444440-94444462 GCGACAGAAACTAAAAACCATGG - Intronic
1087575290 11:99982562-99982584 CAGACTCAAACTTAAAACTAAGG + Intronic
1088183206 11:107135373-107135395 GAGACAGACACTAAAAACCATGG + Intergenic
1088632688 11:111789141-111789163 CAAAAAGAAAGTAAAAACCTGGG - Intronic
1088970928 11:114774163-114774185 CAGACTGAAACTCAGAAACATGG - Intergenic
1089231410 11:116980364-116980386 GAGAGAGAAACTAAAAACAATGG + Intronic
1089714512 11:120345140-120345162 GAGACAGAAACTAAAAACCATGG - Intronic
1089935732 11:122362264-122362286 CAGACAGCAAGTAAATTCCAGGG + Intergenic
1090517630 11:127446030-127446052 CAGAGAGGAATTTAAAACCAAGG + Intergenic
1090652559 11:128820335-128820357 CACAGAGAAAATAAAAATCACGG + Intergenic
1090740164 11:129652263-129652285 CATAAAGAAACAAACAACCATGG + Intergenic
1090746283 11:129707698-129707720 GAGACAGAAACTAAAAACCATGG - Intergenic
1090841153 11:130488235-130488257 CAGAGAGAAATGAACAACCAAGG + Intergenic
1091356116 11:134938885-134938907 GAGACAGAAACTAAAAACCATGG + Intergenic
1091969460 12:4773437-4773459 CAGGCAAAATCTTAAAACCAGGG + Intronic
1092135523 12:6144273-6144295 CAAACAAAAACAAAAAACAATGG + Intergenic
1092312537 12:7374056-7374078 GAGACAGAAACTAATAACCATGG + Intronic
1093105063 12:15076342-15076364 AAGACAAAAACAAAAAATCAAGG + Intergenic
1093551157 12:20413387-20413409 GAGACAGAAACAAAGATCCATGG - Intronic
1093569973 12:20655552-20655574 GAGACAGAAACTAAAAACCATGG + Intronic
1094264693 12:28543440-28543462 GAAACAGAAACTAAAAACCACGG - Intronic
1094577080 12:31696532-31696554 AAGACAGAAACCAAAATCCTGGG + Intronic
1095315163 12:40751609-40751631 AAGCCATAAACTGAAAACCAGGG - Intronic
1095351098 12:41213582-41213604 GAGACAGAAACTAAAAACTATGG + Intronic
1095558054 12:43532277-43532299 CAGACAGAAGCAAAACAGCAAGG + Intronic
1096192919 12:49631823-49631845 AAGACAGAAACCAACCACCAAGG - Intronic
1097788564 12:63788995-63789017 AAGACAGAAACTAAAAGCCATGG - Intronic
1098203141 12:68078530-68078552 GAGACAGAAACTAAAAACTATGG + Intergenic
1098239167 12:68448842-68448864 GAGACGGAAACTAAAAACTATGG - Intergenic
1098353920 12:69591829-69591851 GAGACAGAAACTAAAATCCATGG + Intronic
1098366850 12:69712438-69712460 GATACAGAAACTAAAGCCCAGGG - Intergenic
1099807004 12:87532157-87532179 CACAAAGAAGCTAAAAACCTTGG + Intergenic
1100372114 12:93978043-93978065 GAGAGAGAGACTATAAACCAAGG + Intergenic
1100697064 12:97106360-97106382 AAAACAAAAACAAAAAACCAAGG - Intergenic
1100814941 12:98377745-98377767 AAGACAGCCACTGAAAACCAAGG + Intergenic
1101018421 12:100526683-100526705 CAGGAAGATACTAAGAACCATGG - Intronic
1101274446 12:103183888-103183910 TAGAGAGAAACTAGAAAACAAGG - Intergenic
1101676382 12:106920898-106920920 GAGACAGAAACAAAAAACCATGG - Intergenic
1102627364 12:114245813-114245835 CAGCCAGAAACTAGAGAGCAAGG + Intergenic
1102714779 12:114960798-114960820 CAGTCAGAATCTACAAGCCAAGG + Intergenic
1104485244 12:129145908-129145930 GAGACAGAAACTAAAAACCATGG + Intronic
1104513203 12:129400429-129400451 GAGACAGAAACTAAAAACCATGG - Intronic
1105409450 13:20159949-20159971 CACCCAGGAATTAAAAACCATGG - Intronic
1106068156 13:26379197-26379219 CAGCCAGAAACAAAAGACAATGG - Intronic
1106900722 13:34352293-34352315 GCGACAGAAACTAAAAATCATGG + Intergenic
1108130018 13:47288706-47288728 CAGACAGAAACTAGCATTCATGG + Intergenic
1108394875 13:49982271-49982293 AAGACAGAAACAATAAATCATGG + Intergenic
1109064403 13:57667001-57667023 CAGTCAAAAACGAAAAACGAAGG + Intronic
1110791527 13:79591534-79591556 CAGACACAAACTTTAAAACAAGG - Intergenic
1110794722 13:79622989-79623011 AAGACAGAATCCTAAAACCAAGG - Intergenic
1110889204 13:80677324-80677346 CACACAGAAACTGAAAATAAAGG - Intergenic
1111564114 13:89992180-89992202 CAGATAGAAAAGAAGAACCAGGG - Intergenic
1111600492 13:90468075-90468097 CAAACAAAAAATAAAATCCAAGG - Intergenic
1112491355 13:99867144-99867166 CACACACAAACTGACAACCATGG + Intronic
1113086165 13:106571449-106571471 GAGACAGGGACTAAAAGCCAAGG - Intergenic
1113229085 13:108193627-108193649 CAGACAGAAACAACAAAGCATGG - Intergenic
1113740603 13:112710204-112710226 CAGACACAACTTAAACACCACGG - Intronic
1113749097 13:112766282-112766304 GAGACAGAAATGAAAAACCATGG - Intronic
1115339931 14:32282700-32282722 CAGTCAGAAAATACAGACCATGG - Intergenic
1115379303 14:32716800-32716822 AAGACAGAAAATAAAAACCATGG + Intronic
1115405643 14:33012429-33012451 AAGACAGAAAACAAAAAACATGG - Intronic
1115492608 14:33972762-33972784 CAGAGAGAAACCAAAATCAATGG + Intronic
1115941966 14:38619866-38619888 CAGACACAGACTCAAAACAAAGG + Intergenic
1115975258 14:38990184-38990206 CAGACAGAAACTAAAAACCATGG + Intergenic
1116153131 14:41167390-41167412 CAAACTGAAAATAAAAGCCAAGG - Intergenic
1116297725 14:43134945-43134967 CAAACAAACACAAAAAACCATGG + Intergenic
1116968146 14:51036420-51036442 GAGACAGAAACTGAAATCCATGG - Intronic
1117102432 14:52364153-52364175 GAGACAGAAACTAAAAACCATGG + Intergenic
1117606696 14:57437284-57437306 CACACATAAACTAAAAATAAAGG - Intergenic
1117666111 14:58057978-58058000 CACACAGAAACTCAAATGCATGG + Intronic
1117768709 14:59109760-59109782 GAAACAAAAACAAAAAACCAAGG + Intergenic
1117937394 14:60921742-60921764 TAAAGAGAAACAAAAAACCATGG - Intronic
1118872010 14:69750921-69750943 GAGACAGAAACTAAAAACCCTGG + Intronic
1118962302 14:70545494-70545516 CACACAGAGACTAAAAATAAAGG + Intergenic
1119416308 14:74472282-74472304 CAGAAAGAAGGTAAAAGCCAGGG - Intergenic
1119606644 14:76024014-76024036 GAGACAGAAACTAAAAACTACGG + Intronic
1120258395 14:82150343-82150365 CAGAAATAAACTAATAACTATGG - Intergenic
1120275529 14:82368647-82368669 CAGAGAGAAAAGAAAAACAAAGG + Intergenic
1121968198 14:98329999-98330021 CAGGTAAAAACTAAAAAACAAGG - Intergenic
1122554064 14:102567318-102567340 AAAACAAAAACAAAAAACCATGG - Intergenic
1123203252 14:106687468-106687490 CAAACAGAAAATAAAAAACATGG + Intergenic
1123773182 15:23549556-23549578 GAGACAAAAACTAAAAACTGTGG + Intergenic
1124863114 15:33462215-33462237 CATACAAAATCTAATAACCAGGG - Intronic
1125426817 15:39557013-39557035 GAGACAGAAACTAAAAGCCATGG + Intergenic
1126134990 15:45381104-45381126 AAGGCAGCAACTAAAGACCACGG - Intronic
1126899624 15:53301193-53301215 GAGAGAGAAAATAAAAAGCATGG - Intergenic
1126917798 15:53484768-53484790 GAGACAGAAACTAAAAGCCATGG + Intergenic
1126958517 15:53962742-53962764 AAGAAAGTCACTAAAAACCATGG - Intergenic
1127065398 15:55232077-55232099 CAGGCAGAAAATAAAAGCTAAGG + Intronic
1128789338 15:70421582-70421604 CAAACAGAACTTAGAAACCAAGG + Intergenic
1129572741 15:76706424-76706446 CAGAAGGAAACTAATAAGCAAGG + Intronic
1129862087 15:78870973-78870995 GAGACTGAAACTAAAAACCATGG + Intronic
1129898776 15:79129606-79129628 AAGAAAGAAAATAACAACCACGG - Intergenic
1131024730 15:89130551-89130573 GAGACAGAAACTACAAACCATGG + Intronic
1131361124 15:91791611-91791633 CAAACAAAAACAAAAAACTAAGG - Intergenic
1131642795 15:94310955-94310977 CAAACATAAACAAAAAACTAAGG + Intronic
1132033575 15:98459558-98459580 AAAACAGAAACAAAAAACCAAGG + Intronic
1133469126 16:6057294-6057316 AAGACAGAAAAAAAAAACCCAGG - Intronic
1134229976 16:12421341-12421363 CAGGGAGAGAGTAAAAACCAAGG + Intronic
1134400724 16:13907344-13907366 GAGACAGTAACTTAAAACAATGG - Intergenic
1134613712 16:15632406-15632428 GGGACGGAAACTAAAAACTATGG - Intronic
1134814005 16:17191075-17191097 GAGACAGAAACTAAAAACCATGG - Intronic
1135002347 16:18787342-18787364 GAGACAGAAACTAAGTACCATGG + Intronic
1135087716 16:19488278-19488300 CCAACAGACACTAAAAGCCAGGG + Intronic
1135107582 16:19663858-19663880 CAGACAGAAGCTGAAAATAAGGG - Intronic
1135191001 16:20354715-20354737 AATACAGAAACTAGAAAGCATGG - Intronic
1135425556 16:22332511-22332533 GAGACAGAAACTAAAAACCATGG + Intronic
1135763027 16:25152916-25152938 CAGACAAAAACTGAAAACAAAGG - Intronic
1137459460 16:48647056-48647078 CACACAGAGACTAAAAATGAAGG - Intergenic
1137575271 16:49595314-49595336 CAGACAGAGGCTGAAAATCAAGG + Intronic
1137646506 16:50079827-50079849 AAGACAGACACATAAAACCATGG + Intronic
1138378691 16:56585097-56585119 CAAGCTGAAACTAGAAACCACGG + Intergenic
1138641493 16:58391538-58391560 AAAACAGAAACTAAAATCCATGG + Intronic
1138645686 16:58422740-58422762 TAGACAGTAACCAAAACCCATGG + Intergenic
1138799146 16:60004934-60004956 CAGACAGACAGCAAATACCATGG - Intergenic
1138936529 16:61732376-61732398 CAAACAAAAACTAATCACCAGGG + Intronic
1138999587 16:62493338-62493360 CAGACATTAAGTAAAAACAAAGG + Intergenic
1139026558 16:62824949-62824971 CAGAGAGAGACTGAAAACGATGG - Intergenic
1139348574 16:66321011-66321033 CAGACCTAAGCTATAAACCAAGG + Intergenic
1140489373 16:75321587-75321609 GAGGCAGAAACTGAAAAACATGG - Intronic
1140489974 16:75327273-75327295 CAAAACGAAACAAAAAACCAGGG + Intronic
1140528149 16:75641173-75641195 AAAACAAAAACAAAAAACCAGGG + Intronic
1140757142 16:78077866-78077888 CAGACAAAAAATAAAAAAAAGGG - Intergenic
1140937603 16:79689129-79689151 GAGACAGAAACTAAAATCCGTGG - Intergenic
1141830223 16:86506128-86506150 CAAACAGAAACAAAAACCCCAGG - Intergenic
1143425082 17:6829353-6829375 CTGACAGACACCAAAATCCATGG + Intronic
1144028282 17:11297658-11297680 CACACAGATACTAAGAACAAAGG - Intronic
1144083172 17:11783171-11783193 GAGACAGAAACTAAAAACCATGG - Intronic
1144186914 17:12805224-12805246 CCAACAGCAACTAAAAATCAAGG - Intronic
1144252487 17:13431755-13431777 CTCACAGATACTAAAATCCACGG + Intergenic
1144592049 17:16532586-16532608 GAGACAGAAACTAAAAACCGTGG - Intergenic
1144898991 17:18566514-18566536 CCGAGAGGAACTAAAAAACAAGG + Intergenic
1145133388 17:20379205-20379227 CCGAGAGGAACTAAAAAACAAGG - Intergenic
1145289003 17:21528393-21528415 GAGACAGTAACTCAAAACCTCGG - Exonic
1146937149 17:36818984-36819006 CAGGCAGAAACTAAACAAGAAGG + Intergenic
1146966236 17:37033226-37033248 CAGAAATGAACAAAAAACCATGG - Intronic
1147138361 17:38447859-38447881 CAGCCACAAAGTAAACACCAGGG - Intronic
1148528493 17:48365940-48365962 GAGGTAGAAACTAAAAATCATGG + Intronic
1149317519 17:55452475-55452497 CAGACAGAATTTGAAATCCATGG - Intergenic
1149906579 17:60532071-60532093 CACACATAAACTAAAAATAAAGG + Intergenic
1150585062 17:66510050-66510072 GAGATAGAAACTAAAAAACATGG - Intronic
1151544896 17:74786726-74786748 CATGAAGAAACTGAAAACCATGG - Intronic
1151930359 17:77228178-77228200 CAGACAGAAACAGAAAACGAAGG - Intergenic
1152225859 17:79092362-79092384 CAGACATACAGGAAAAACCAGGG + Intronic
1152324513 17:79627795-79627817 GAGACAGAAACTAGCAACCTGGG - Intergenic
1153355149 18:4125934-4125956 CACAGAGAAACAAAAAACTAAGG + Intronic
1153356981 18:4148083-4148105 GAGACAGAAACTAAAAGCCATGG + Intronic
1153400657 18:4680699-4680721 AAAACAAAAACAAAAAACCAAGG + Intergenic
1154003754 18:10507948-10507970 CAGACAGCAACAATAAACCCTGG - Intergenic
1155414957 18:25587952-25587974 AAGACCCAAACTAAAAAACAAGG - Intergenic
1155488086 18:26369210-26369232 CAGAAGGAAACTAAAAAAAAGGG + Intronic
1155689529 18:28601545-28601567 CAAACAAAAAATAGAAACCAAGG - Intergenic
1155713777 18:28913904-28913926 AAAACAGATACTAAAAATCAAGG - Intergenic
1155772185 18:29715589-29715611 CAAACAAAAACAAAAAAACAAGG - Intergenic
1155928094 18:31679053-31679075 CACACAGACACTACAAACCTAGG + Intronic
1156272269 18:35546753-35546775 GAAACAGAAACTAAAAACCATGG - Intergenic
1156488885 18:37485053-37485075 CGCACAGAAGCTATAAACCAGGG + Intronic
1157381580 18:47223029-47223051 CAGACAGAAATTTAAAACTTTGG + Intronic
1157795366 18:50569651-50569673 AAGATAGAAACTAAAAACCATGG + Intronic
1157841891 18:50966818-50966840 CAAACAAAAACCCAAAACCAGGG + Intergenic
1157844822 18:50993487-50993509 CAGACAGAAACCTAGACCCATGG + Intronic
1157927452 18:51781784-51781806 GAGACAGAAACTAAAAACCATGG - Intergenic
1157968086 18:52231621-52231643 CAGAAGAAAACTAAAAACTAAGG - Intergenic
1158714739 18:59868129-59868151 AAAACAGAAACAAAAAACAAAGG + Intergenic
1158718803 18:59905046-59905068 CAGATTGAAGCTAAAAACTAGGG - Intergenic
1158781551 18:60658089-60658111 AAGAGAGAAACTAATAACCATGG + Intergenic
1158927315 18:62281047-62281069 GAGACAGAAACTAAAAACCCCGG + Intronic
1159469429 18:68832546-68832568 GAAACAGAAGCTAAAAACCAAGG - Intronic
1160234037 18:77071480-77071502 GAGACAGAAACTAAAAACCATGG - Intronic
1160421315 18:78748139-78748161 CATTCAGAAAATGAAAACCATGG - Intergenic
1162171757 19:8795283-8795305 GAGACAGAAACTAGAAACCATGG + Intergenic
1162293507 19:9796675-9796697 GAAACAGAAACTAAAAACCATGG - Intergenic
1162564338 19:11436846-11436868 CACACAAAAACAAAAAGCCAGGG - Intronic
1163258352 19:16171569-16171591 CACACAGAAACCTAAACCCAGGG - Intronic
1166158723 19:40935807-40935829 GAGACAAAATCTGAAAACCATGG - Intergenic
1166167651 19:41003711-41003733 GAGACAGAAACTGAAAACCATGG - Intronic
1166303163 19:41923459-41923481 CAGACAGAGACAAAAAGACAGGG + Intronic
1167461697 19:49628148-49628170 GAGACAGAAACTAAAAACCATGG + Intergenic
1167664487 19:50816022-50816044 AAAACAAAAACAAAAAACCAAGG + Intergenic
1167983314 19:53294327-53294349 CAGAAACAAACTAAGAACCCAGG + Intergenic
925456373 2:4019915-4019937 CAGTCAGGAACTTAAAGCCAGGG + Intergenic
925459962 2:4053328-4053350 CAAACAGAAACAAAAAAGCCAGG - Intergenic
925560927 2:5194385-5194407 CAGCAAGATACAAAAAACCAAGG + Intergenic
925703226 2:6659574-6659596 CAGACATAAGCTGAAGACCAGGG + Intergenic
926567548 2:14493257-14493279 CAGACATATACTCAAAACAATGG - Intergenic
927584320 2:24285589-24285611 ATGAAAGAAACTAAAAACCCAGG - Intronic
929093192 2:38239938-38239960 CAGATAGGAGCTACAAACCAGGG - Intergenic
929284587 2:40121053-40121075 GAGACAGAAACTAAAAACCATGG - Intronic
929543106 2:42837520-42837542 AAGAAAGAAACTAATGACCAGGG - Intergenic
930036398 2:47088051-47088073 CAAACAAAAACAAAAAACCCCGG - Intronic
930112322 2:47689118-47689140 GAGACAGAAACTAAAAACCATGG - Intergenic
930268217 2:49224832-49224854 CAGGCAGAGACTCGAAACCAGGG - Intergenic
930735680 2:54776176-54776198 GAGTCAGAAACTAAAAAACATGG - Intronic
930926018 2:56818770-56818792 CAGAAAGAAAAAAAAAAGCAGGG + Intergenic
932890162 2:75587883-75587905 CTGAGAGAAATTAAATACCAAGG + Intergenic
933037543 2:77419368-77419390 CTCACAGATACTAAAATCCATGG + Intronic
933249461 2:80012683-80012705 TCGACAAAAACTAAAACCCACGG - Intronic
933262153 2:80142725-80142747 GAGACAGAAACTAAAAACCATGG - Intronic
934233341 2:90206923-90206945 CACACAGAAAAAAAAAATCATGG + Intergenic
934987290 2:98896792-98896814 GAGACAGAAACTAAAAACCATGG - Intronic
935223141 2:101031930-101031952 AAGTCAGAAAGTGAAAACCAGGG - Intronic
935524767 2:104152288-104152310 TAGACACAAACTAAGAACCTGGG - Intergenic
935609625 2:105007776-105007798 GAGACAAAAACTAAAAACCATGG - Intergenic
935764861 2:106356674-106356696 CAGACAGCAACTTTAAAGCATGG + Intergenic
935917697 2:107973847-107973869 GAGACAGAAAGTAAAAATCACGG - Intergenic
935995812 2:108771619-108771641 CTAACTGAAAATAAAAACCATGG - Intronic
936263556 2:110982120-110982142 CAAACCAAAACAAAAAACCACGG - Intronic
937524715 2:122754401-122754423 GAGACAGAAACTAAAAGCCATGG + Intergenic
938218448 2:129544018-129544040 CAGACAGAAGATATAAAACAAGG - Intergenic
938398454 2:130967755-130967777 CTGACAGAAGCTCAAAAACATGG + Intronic
938412722 2:131078398-131078420 AAAACAGAAACTATAAAACAGGG + Intronic
938622704 2:133073140-133073162 CAGACACAAACAGAAAATCAAGG + Intronic
939204442 2:139081832-139081854 CAAACACAAACAAAAAACAATGG + Intergenic
939899867 2:147838859-147838881 CAGAGATTAAATAAAAACCAGGG - Intergenic
939932133 2:148248532-148248554 CTGTCAAAAATTAAAAACCAAGG + Intronic
940158662 2:150687565-150687587 AAGACAAAACCAAAAAACCAAGG - Intergenic
940619671 2:156095478-156095500 CAGCCCGAAACTTAAAAACAAGG + Intergenic
940678387 2:156752942-156752964 GAGACAGAAACTAAAGACCATGG + Intergenic
940709219 2:157142382-157142404 AAAACAAAAAATAAAAACCAAGG - Intergenic
940861521 2:158774965-158774987 CAAACAGAAATGAAAACCCAGGG - Intergenic
941406678 2:165098604-165098626 GAGATAGAAACTAAAAACCATGG + Intronic
941478911 2:165982124-165982146 GGGACAGAAACTAAAAGTCATGG - Intergenic
941633892 2:167914701-167914723 CAGAGAGCAAACAAAAACCAAGG + Intergenic
942535504 2:176958714-176958736 GAGACAGCAACAAAAATCCAGGG + Intergenic
942895766 2:181052368-181052390 GAGACAGAAACTAAAACCCATGG + Intronic
943245364 2:185442187-185442209 TATACAGAAACCAAAAAGCAAGG + Intergenic
944136855 2:196409101-196409123 CAAACAAAAACAAAAAACCCTGG - Intronic
944239517 2:197472386-197472408 GAGACAGAAACTAAAACCCATGG + Intronic
944290414 2:197998084-197998106 GAGACAGAAACTGAAAACTGAGG + Intronic
945113435 2:206387454-206387476 TAGACAAAAACTACAAACAATGG + Intergenic
945484557 2:210379928-210379950 CAGTCAAAAAATAAAAAACAAGG + Intergenic
945512246 2:210716983-210717005 CAGAAGCAACCTAAAAACCATGG + Intergenic
946446227 2:219741866-219741888 CAGCCATAAGCTACAAACCAGGG - Intergenic
946471982 2:219969055-219969077 AAGCCAGAAATTAAAAAACAAGG - Intergenic
946870779 2:224082885-224082907 CAGGCTGAAACAAAAAAGCAAGG - Intergenic
947074779 2:226330725-226330747 CACACAGAAGCTATAGACCAGGG - Intergenic
947130818 2:226922931-226922953 GAAACAAAAGCTAAAAACCAGGG - Intronic
947154613 2:227149453-227149475 GAGAAAGAAACTAAAAATCATGG + Intronic
947365399 2:229389242-229389264 CTGATAGAAATTACAAACCAGGG + Intronic
948621480 2:239237827-239237849 AAGACAACAACAAAAAACCACGG + Intronic
1170138593 20:13102845-13102867 CAGGCAGAACCTAGAAACCAGGG - Intronic
1170471104 20:16669187-16669209 CATACAGAGAATAAGAACCACGG + Intergenic
1170813548 20:19694261-19694283 TGGACAGAAATTAAAAAGCATGG + Intronic
1171075910 20:22123144-22123166 GAGACAGAAACTAAAAACTATGG - Intergenic
1171178666 20:23075028-23075050 CAAACAGAAATCATAAACCAGGG + Intergenic
1172372249 20:34403467-34403489 GAGACAGAGACTAGAAAGCAGGG + Intronic
1172736349 20:37128741-37128763 GAGACAGAAACTAAATACCATGG + Intronic
1173037250 20:39424345-39424367 GAGACAGAAACTAAAAACCATGG - Intergenic
1173463931 20:43266343-43266365 GAAACAGCAACAAAAAACCAAGG - Intergenic
1173550866 20:43932455-43932477 CAGACAGCAAATAGAAAACAGGG + Intronic
1173634925 20:44547008-44547030 CAGACACAAAATAAACACAAAGG - Intronic
1173909435 20:46653463-46653485 GAGACAGAAACTAAAAACCATGG + Intronic
1174391045 20:50218495-50218517 CAGACAGAGTCTAAGAAACACGG + Intergenic
1176668303 21:9707903-9707925 CACACAGAAAATAAAAATAAAGG - Intergenic
1176892213 21:14331930-14331952 CAAACAGCATATAAAAACCATGG + Intergenic
1177138836 21:17336163-17336185 CACTTAGAAAATAAAAACCATGG - Intergenic
1177376598 21:20278650-20278672 TAAACAGAAAATAAAAACAATGG + Intergenic
1177397774 21:20560022-20560044 CAGACAGGAACTACAAAAAATGG + Intergenic
1177581368 21:23026424-23026446 AAAATAAAAACTAAAAACCAAGG - Intergenic
1178292315 21:31379302-31379324 CCCACAGATACTAAAATCCATGG - Intronic
1178362359 21:31959077-31959099 TAGAAAGAAACTTATAACCATGG - Intronic
1178398402 21:32262692-32262714 AAGAGAAGAACTAAAAACCATGG + Intergenic
1179440014 21:41386941-41386963 AAGACAGAAACCAAAAACCATGG + Intronic
1180712974 22:17852469-17852491 CAGACAGACACTAAGAACAAAGG + Intronic
1181731075 22:24847232-24847254 CAAAAACAAACAAAAAACCATGG + Intronic
1184316954 22:43701587-43701609 AAAACAGACACTAAAAACAATGG + Intronic
949530629 3:4951741-4951763 GAGACAGAAACTAAAAACCACGG - Intergenic
950358828 3:12435844-12435866 GGGACAGAAATTAAAAACCATGG + Intergenic
951281925 3:20761662-20761684 TACACAGAAAATAAAAAGCAAGG - Intergenic
951351510 3:21612424-21612446 GATAAAGAAACTAAAAATCAGGG + Intronic
951582879 3:24184568-24184590 CAGACAGAAATAGAAAGCCAAGG - Intronic
951725471 3:25753005-25753027 CAGAAAGACAGTAAAAACAATGG + Intronic
951867487 3:27324351-27324373 CAGACTGAAACTAGAACCCATGG + Intronic
951922545 3:27872323-27872345 TAGACAGAAACTAAAAACCATGG - Intergenic
951990140 3:28667610-28667632 CAGACAGAAACTAAAAACAATGG + Intergenic
952606152 3:35149157-35149179 GAGACAGAAACTAAAAATTGTGG + Intergenic
953286281 3:41612921-41612943 CAGACAGAAGCTGGAAAACAGGG + Intronic
953480467 3:43247224-43247246 CAGTCAAAAACAAAAAACCCTGG + Intergenic
953758756 3:45670188-45670210 CAGAAGGACACTAAAAACAAAGG - Intronic
955139002 3:56250241-56250263 CAAAGATAAACTAAAAACTAGGG + Intronic
955191415 3:56765263-56765285 GAAACAGAAACTAAAAACCATGG - Intronic
955789891 3:62577958-62577980 CAAACAGAAAATAAAAAGCAAGG + Intronic
955810420 3:62782149-62782171 GAGACAGAAAAGAAATACCAGGG + Intronic
955829840 3:62989484-62989506 CAGCCAGAAGCCAAGAACCAAGG - Intergenic
956633335 3:71337883-71337905 CAGACAGACACTCCAAACAAGGG + Intronic
956637120 3:71376771-71376793 CAGACAGAATCTGAGAACCATGG + Intronic
956808062 3:72836682-72836704 CAGAAACAAACTAAAAGCAAAGG + Intronic
956987681 3:74721986-74722008 CAAGCAGAAACTGAAAGCCAAGG - Intergenic
957190664 3:77004998-77005020 GAGACAGAAACGAAAAACCATGG + Intronic
957309041 3:78495487-78495509 CTGACAGAAGCTAAAAGTCATGG + Intergenic
957391883 3:79585186-79585208 TAAAAAGAAACTAATAACCATGG - Intronic
957944373 3:87043899-87043921 GAGATAGAAACTAAAAACAATGG - Intergenic
959015826 3:101132918-101132940 GAGACAGAAGCTAAAAACCATGG + Intergenic
959042105 3:101433543-101433565 CACACATAAACTAAAAATAAAGG + Intronic
959344767 3:105179394-105179416 AAAACAGAAAAAAAAAACCAAGG + Intergenic
959550619 3:107651904-107651926 GAGACAGAAACTAAAAACCATGG - Intronic
959875333 3:111375276-111375298 AAAACAAAAACAAAAAACCAAGG + Intronic
959909801 3:111751208-111751230 CAGACAGATAGTAACCACCAGGG + Intronic
960026634 3:113018575-113018597 TAGAGACAAACTAAAAACCATGG - Intronic
960266668 3:115627946-115627968 CAGAAGGAAACTGAAACCCAAGG - Intronic
960735815 3:120779110-120779132 AAGACAGAAAACAAAAAACAAGG - Intronic
960811346 3:121630488-121630510 GAGACAGAAACTAAAAACCATGG - Intergenic
961123958 3:124399064-124399086 CAGACAGAAAGTAAAATAGAGGG - Intronic
961229375 3:125288978-125289000 AAGAAAGAAAAGAAAAACCAAGG + Intronic
961480737 3:127178178-127178200 CATAAAGAAAATTAAAACCAGGG + Intergenic
961524494 3:127488160-127488182 CAAACAGAAAATGTAAACCAGGG + Intergenic
962614207 3:137108649-137108671 CAGGCAGAAATTAAAAAGCCAGG - Intergenic
962712095 3:138096597-138096619 AAAAGAGAAAATAAAAACCATGG - Intronic
963270062 3:143277705-143277727 CAGAAAGCCACTAAAAGCCAAGG - Intronic
963430774 3:145199187-145199209 TAGACAAAAAATAAAAATCAGGG + Intergenic
965874203 3:173297828-173297850 AAAACAAAAACAAAAAACCAAGG - Intergenic
966201992 3:177367176-177367198 GAGACAGAAAACAAAACCCAGGG + Intergenic
967392875 3:188974358-188974380 CAAACACAAAACAAAAACCAGGG - Intronic
967533738 3:190578368-190578390 CAGACAGAAACAAAGAGCCAAGG - Intronic
967548080 3:190756135-190756157 CAGACAGAAACAAAGAACAAAGG - Intergenic
967576293 3:191097377-191097399 CTGCCAGAAACTCAAAACCAAGG - Intergenic
967788524 3:193522947-193522969 CACACAGCAACTAAAACCCTTGG + Intronic
968507987 4:980791-980813 GAGACAGAAACTAAAAACCAGGG + Intronic
968574647 4:1359982-1360004 GGGACAGAAACTGAAAACCCAGG + Intronic
970313531 4:14807765-14807787 GAGACAGAAACTAAAATCCATGG + Intergenic
970965003 4:21918208-21918230 CAGAGTGAAACTAAAAATAATGG + Intronic
971258826 4:25037774-25037796 CAGACTTAAACTAATCACCATGG + Intergenic
971435135 4:26613386-26613408 GAGACAGAAACCAAAAACCATGG - Intronic
972143526 4:35991651-35991673 TAGAAAGAAAATAAATACCATGG + Intronic
972556428 4:40186134-40186156 CAGACAGACTCCAAAAACAAGGG - Intergenic
973102852 4:46294154-46294176 CAGACAGAAACTAATCACTTTGG + Intronic
973687440 4:53386862-53386884 GAGACAGAAACTAAAAACCATGG - Intronic
973949335 4:55995360-55995382 TAGAGACAGACTAAAAACCATGG - Intronic
974611129 4:64217926-64217948 GAGCAAGAAACTAAAAGCCACGG + Intergenic
974847254 4:67365932-67365954 CTGACAAAAACTAAATAGCATGG + Intergenic
974858861 4:67495493-67495515 GAGACAGAAACTAAAAAGCATGG - Intronic
974910009 4:68106329-68106351 GAGACAGATAGTAAAAAGCAGGG + Intronic
975067655 4:70088195-70088217 AGGACAGAAATTAAAAACAAAGG - Intergenic
975142308 4:70930400-70930422 TAATCAGAAACTAAAAACCCTGG - Intronic
975912338 4:79281830-79281852 GAGACAGAAACTAAACACCATGG + Intronic
976756669 4:88505987-88506009 GAGACAGAAATGAAAAACCATGG - Exonic
977331353 4:95641311-95641333 CAAACTGAAAGTAACAACCAAGG - Intergenic
977375845 4:96203077-96203099 CAGTTGGAAATTAAAAACCATGG + Intergenic
977474109 4:97483159-97483181 AAAACAGAAACCAAAAACCAAGG + Intronic
977664340 4:99628246-99628268 GTGACAGACACTAATAACCACGG + Intergenic
977795858 4:101163729-101163751 CAACCAGAAACTTTAAACCATGG - Intronic
977807273 4:101315874-101315896 GAAACATAAACTAAAAACCATGG + Intronic
977961841 4:103095075-103095097 GAGAGAGAATCTAAAAAGCACGG + Intronic
978188556 4:105886407-105886429 CAGAGAGAAAATCAAGACCAGGG + Intronic
979069740 4:116186625-116186647 TAGAAAGAAACTCAAAGCCAAGG - Intergenic
979163318 4:117492189-117492211 AAGAGAGAAAGTAAAAAGCAGGG - Intergenic
979350725 4:119641690-119641712 TAAACTGAAACTAAAAAACAGGG + Intergenic
979677040 4:123420825-123420847 CAGACAGAAAAAAAAAAAAATGG - Intergenic
979788456 4:124747487-124747509 CACACAGGAAATAATAACCAGGG + Intergenic
980031141 4:127832495-127832517 CAGACATATACTAACAAACAAGG + Intronic
980664155 4:135906695-135906717 CAGAAAGAAACAAAATACCTAGG - Intergenic
980730505 4:136817804-136817826 CAGAAGGAAGCTAAAAACCTGGG - Intergenic
980797146 4:137699332-137699354 CAGACAGAAAATAAATACTCTGG + Intergenic
981499075 4:145428074-145428096 CAGACAGAAACAGAAAACCATGG - Intergenic
981642791 4:146964833-146964855 CAGAAAGAAAATGAAAACAAAGG + Intergenic
982574871 4:157096995-157097017 CAAACTAAAACTTAAAACCAAGG - Intronic
983283471 4:165710024-165710046 CAGACAGAAAACAAAAATCTTGG + Intergenic
983462515 4:168046285-168046307 CAGAGAGACAATAAAAATCAAGG - Intergenic
983470945 4:168153375-168153397 GAGAGAGAAACTAAAAACCATGG + Intronic
983851206 4:172582801-172582823 GAGTCAGAAAGTAAAAACAAAGG - Intronic
984331179 4:178321104-178321126 GAGACAGAAACTAAAAACCATGG - Intergenic
984361273 4:178736348-178736370 AAGAGACAAACGAAAAACCAGGG - Intergenic
984968496 4:185164630-185164652 GAGACAGAAACTAAAAACCATGG + Intronic
985160324 4:187037498-187037520 CAGAAAGAAACTACAAGCAATGG + Intergenic
985406478 4:189643588-189643610 CACACAGAAAATAAAAATAAAGG + Intergenic
986039404 5:3975097-3975119 CAAACAGAAAAAAAAAACAAAGG + Intergenic
986565182 5:9106029-9106051 CAGACAGAAACCAAAATGCATGG + Intronic
986736009 5:10667773-10667795 CATACAGAGACTAAAAGTCAAGG - Intergenic
986896882 5:12381894-12381916 GAGACAGAAACTAAAAACCATGG + Intergenic
987085755 5:14465998-14466020 CAAACAGACACTCAACACCAAGG - Intronic
987234945 5:15933519-15933541 AAGAAAGAAACTCAAAACAAAGG + Intronic
987611643 5:20212011-20212033 CACAAAGAAGCTAAAAACCTTGG + Intronic
987878110 5:23707169-23707191 GAGACTGAAACTCAAAACGATGG + Intergenic
988642711 5:33059089-33059111 CACAAACAAACAAAAAACCAGGG - Intergenic
988985976 5:36619265-36619287 TTGACAGAAACAAAAGACCAGGG + Intronic
989027481 5:37084372-37084394 AAAACAAAAACAAAAAACCAAGG + Intergenic
989059392 5:37395380-37395402 GAGACAGAAACTAAAAACCACGG - Intronic
989175431 5:38520550-38520572 AAGACTGAAACTATAAAACATGG - Intronic
989261436 5:39423888-39423910 CAAACAAAAACTAAAAAGAAAGG + Intronic
989308050 5:39980361-39980383 GAGACAGTAACTTAAAACCATGG + Intergenic
990401607 5:55443793-55443815 CAGACAGGGATTAAAAACAAAGG + Intronic
990497208 5:56360420-56360442 CACAAATATACTAAAAACCATGG - Intergenic
990550747 5:56875653-56875675 TAGAGACAGACTAAAAACCATGG + Intronic
990795062 5:59530395-59530417 CAGGCAGATACCAAAATCCATGG + Intronic
990805455 5:59655647-59655669 GAGACAGAAGCTAAAAACCATGG - Intronic
991261884 5:64676724-64676746 GAGACAGAAACTAAAAACCATGG + Intergenic
992090294 5:73310917-73310939 GAGTCAGAGACTAAAATCCATGG + Intergenic
992422647 5:76622004-76622026 GAGACAGAAACTAAAAACCATGG + Intronic
993003781 5:82409402-82409424 GAGACAGGAACCAAAACCCAAGG - Intergenic
993227628 5:85187623-85187645 GAAACAGAAACTAAAAACTACGG - Intergenic
993525758 5:88963861-88963883 CAGACTGAACCAAAACACCAAGG + Intergenic
993797911 5:92292395-92292417 AACACACAAAATAAAAACCAGGG - Intergenic
994250206 5:97527390-97527412 CTGAGAAAAACTAAAAATCAGGG - Intergenic
995322096 5:110846937-110846959 CAGAAAAAAAGTACAAACCAGGG - Intergenic
995644809 5:114299525-114299547 CAGAAAGAAACTGAATCCCAAGG - Intergenic
996078491 5:119227135-119227157 CATACAGCTACTAAAACCCATGG - Intronic
996517379 5:124387170-124387192 CAGACAGCAAAAGAAAACCATGG + Intergenic
996835723 5:127789944-127789966 CAGAGAGAAGCTAAACCCCAAGG - Intergenic
997037986 5:130215646-130215668 AAAACATAAACTAACAACCATGG - Intergenic
998058697 5:139101935-139101957 CAGAGAGATACTCAAAATCATGG + Intronic
998613090 5:143710664-143710686 CAGACAGAACTTGAAAGCCAAGG + Intergenic
998877551 5:146615646-146615668 CAGCTACAAATTAAAAACCAAGG + Intronic
999057852 5:148599674-148599696 CAAACAGAAATGAAAAACAATGG + Intronic
999415702 5:151394315-151394337 CACAAAGAAGCTAAAAACCTTGG - Intergenic
999482315 5:151959999-151960021 GAGACAGAAACTAAAAACCATGG - Intergenic
999801087 5:155037415-155037437 AAAACAAAAACAAAAAACCAAGG - Intergenic
999913184 5:156228698-156228720 AAAACAAAAACAAAAAACCACGG - Intronic
1000707658 5:164531264-164531286 CAGACAGAAACTTGAAAATATGG - Intergenic
1001817081 5:174678660-174678682 GAGACAAAAACTAAAAACCATGG - Intergenic
1002946186 6:1763510-1763532 TGGACAGACATTAAAAACCATGG + Intronic
1003170496 6:3718325-3718347 AATACAGAAACTAGAAACCATGG - Intergenic
1003253061 6:4449411-4449433 GAGACAGAAACTAAAAACCAAGG - Intergenic
1003299884 6:4869917-4869939 CAGACAGTAATGCAAAACCATGG - Intronic
1003380070 6:5616893-5616915 CAGAGAGATGCTAAAAACCTAGG + Intronic
1004314028 6:14570861-14570883 AAAACAGAAACTAAAAGACACGG - Intergenic
1005208289 6:23430571-23430593 CAAACAAAAAAAAAAAACCAAGG - Intergenic
1005366531 6:25083830-25083852 GAGAGACAAACTAAAAACCGAGG - Intergenic
1005784185 6:29226052-29226074 CAGACAGAAAGTAGAATACATGG - Intergenic
1005858929 6:29886912-29886934 CACACAGAAACTCAAAGCTATGG + Intergenic
1005956481 6:30667078-30667100 CACACACAAACAAAAAACAAGGG + Intronic
1005963110 6:30707456-30707478 TAGACAGAAAGTAAACACAAAGG + Intronic
1008554692 6:52663567-52663589 GAGACAGAAACTAAAAACCACGG - Intergenic
1008793252 6:55265981-55266003 GAGACAGAAACTAAAAACCAGGG + Intronic
1009387853 6:63108771-63108793 CACACATAAGCTAAAAACAAAGG - Intergenic
1009401947 6:63266998-63267020 CAGTCAAAAACTAAATACCTCGG + Intergenic
1010085096 6:71908139-71908161 AAAACAGAAACTAAAAGCCAAGG - Intronic
1010106176 6:72170636-72170658 CAGACAGAAACAAAACATAATGG - Intronic
1010627665 6:78158230-78158252 GAGACAGAAACTAAAACCCATGG - Intergenic
1010744375 6:79544151-79544173 GAGACAGAAATTAAAAACCATGG + Intergenic
1010786526 6:80008091-80008113 AAGAGAGAAAATAAAAAACATGG + Intronic
1011082301 6:83502975-83502997 AAGAGAGAGAATAAAAACCAAGG - Intergenic
1011093328 6:83631895-83631917 AAAACAAAAACAAAAAACCAAGG - Intronic
1011236258 6:85220732-85220754 CACACAGAGACTAAAAATAAAGG + Intergenic
1011348157 6:86393805-86393827 CACAAAGAAGCTAAAAACCTTGG + Intergenic
1011899077 6:92269866-92269888 CAGAGATAAACTAAAATTCAAGG - Intergenic
1012483545 6:99694441-99694463 CACACATAAACTAAAAATAAAGG + Intergenic
1012559446 6:100561473-100561495 CAGACTGAAACTTAAAAGCAGGG - Intronic
1012819632 6:104069723-104069745 GAGACAGAAACTAGAAACCATGG - Intergenic
1013144256 6:107372241-107372263 GAGAGAGAAACCAAAAACCAGGG - Intronic
1013203760 6:107927734-107927756 CCCACAGATACTAAAATCCATGG + Intronic
1013345553 6:109256876-109256898 AAAATAGAAACTAATAACCATGG + Intergenic
1013474037 6:110491190-110491212 AAAACAAAAACAAAAAACCACGG - Intergenic
1013944390 6:115704511-115704533 TAGAGACAAACTAAAAACTATGG + Intergenic
1014235008 6:118943882-118943904 CACACATAAACTAAAAACAAAGG + Intergenic
1014523197 6:122470257-122470279 AACACAGAAACTAAAAGGCAGGG + Intronic
1014855336 6:126394271-126394293 TAGACAAAAAATAAAAAGCAAGG - Intergenic
1014992256 6:128095460-128095482 GAAACAGAAACTAAAAACCATGG - Intronic
1015335106 6:132027970-132027992 AAGACAGAAACTAAAATCCATGG - Intergenic
1015663126 6:135598785-135598807 AAAACAAAAACAAAAAACCAAGG - Intergenic
1017107715 6:150903797-150903819 CAGCCAGAAGCTGAAAAGCAGGG + Intronic
1019940413 7:4284802-4284824 CAGACAGAAACCAATAAGTAAGG + Intergenic
1019943572 7:4309739-4309761 CAGACACAACCCAAAGACCACGG - Intergenic
1020515257 7:9109663-9109685 CACACAGAGACTGAAAATCAAGG + Intergenic
1021064477 7:16156576-16156598 CAGAGAAAAACTAAAAGACAAGG + Intronic
1021237271 7:18157141-18157163 CAGACAGAGACACAAAAGCATGG + Intronic
1021505362 7:21378040-21378062 CATTCTGACACTAAAAACCAGGG + Intergenic
1021768747 7:23977114-23977136 CATACAAAAAATAAAAAGCAGGG - Intergenic
1022435839 7:30384153-30384175 GAGACAGAAACTAAAAACCATGG + Intronic
1022627173 7:32049442-32049464 TAGACAGAAACTAAAAATCATGG - Intronic
1023218421 7:37891731-37891753 GAGACAGAAACTAAAAACCATGG + Intronic
1023331592 7:39123366-39123388 CAGACAGGAGTTAATAACCAAGG + Intronic
1023394114 7:39736451-39736473 AAGACAGAAACTAAAAACAAAGG - Intergenic
1023740548 7:43277416-43277438 CAGACAGAAACGAAAAACCATGG - Intronic
1024043001 7:45569308-45569330 CAGATGGCAACTAGAAACCATGG - Intergenic
1024856328 7:53784660-53784682 CAGACATAAATTAAAAAGTAAGG + Intergenic
1024924395 7:54598067-54598089 GAGACAGAAACTAAAAACCATGG + Intergenic
1025121367 7:56306809-56306831 GAGACAGAAACTAAAAATCATGG - Intergenic
1026210000 7:68295605-68295627 AAGACTGAAACTGAAAGCCATGG - Intergenic
1027850818 7:83449552-83449574 CAGAGACAAAATAAAAACCCAGG + Intronic
1027991427 7:85367379-85367401 CACACATACACTAAAAATCAAGG - Intergenic
1028114259 7:86979927-86979949 GAGACAGAAACTAAAAATCATGG + Intronic
1028871440 7:95774560-95774582 TAGTCAGAAACTGAAGACCATGG - Intronic
1029159636 7:98542476-98542498 AAGAAAGAAACAAAAAACCAGGG - Intergenic
1029235446 7:99112592-99112614 AAGACATAAACAAAAAACTATGG + Intronic
1029630478 7:101747260-101747282 GAGACAGAAACTAAAAACCATGG + Intergenic
1030237214 7:107277393-107277415 GAGATAGAAACTAAAAACCATGG + Intronic
1030792064 7:113742269-113742291 CAAACAGAAACAAAGAACAAGGG - Intergenic
1031718847 7:125143190-125143212 GAGAGAGAAACAAAAAACAAAGG - Intergenic
1031764441 7:125760773-125760795 AAGACAGAAAGTAAAAAAAAAGG + Intergenic
1031884389 7:127230726-127230748 GAGACAGCATCTATAAACCAGGG + Intronic
1032222527 7:130005479-130005501 AAGACAGAAAAAAAAACCCAAGG + Intergenic
1032990714 7:137391796-137391818 CATACAGAAACTAAAAGGAAGGG + Intronic
1033281411 7:140009220-140009242 CAGACAGAAACTAGAGAACCTGG + Intronic
1034480800 7:151319199-151319221 GAGACAGAAACTAAAAACCATGG + Intergenic
1036134191 8:6144092-6144114 CAGAAAGAAACTAAAAATGTAGG + Intergenic
1037342779 8:17864321-17864343 CAGACAAAACATAAAAAGCATGG - Intergenic
1038626428 8:29197708-29197730 GAGATAGAAACTAAAGACCATGG + Intronic
1038692698 8:29777317-29777339 CAGATAAAAAATTAAAACCATGG - Intergenic
1039431536 8:37528966-37528988 GAGACAGAAACAAAAAACTAGGG + Intergenic
1039600525 8:38833211-38833233 GAGACAGAAACTAAAAACTATGG - Intronic
1041201872 8:55457647-55457669 CAGACAGAAACTAAAGTTCACGG + Intronic
1041275756 8:56156079-56156101 CAAACAAAAAATAAAAAGCAGGG + Intergenic
1041572508 8:59353216-59353238 AAGACAGAAACTAAAAACCATGG - Intergenic
1041607312 8:59797588-59797610 ATGACAGAAAATATAAACCAAGG + Intergenic
1041678411 8:60560987-60561009 CTGAAAGAAAAGAAAAACCAAGG + Intronic
1041978538 8:63828252-63828274 AAGACAGAAACTAAAAACCATGG - Intergenic
1042199232 8:66264313-66264335 GAGACAGAAACTGAAAACCATGG - Intergenic
1042244018 8:66693051-66693073 CAGACAGAAAGGAAAGGCCAAGG - Intronic
1042443840 8:68860763-68860785 CAAAGAGAAATTAAAAACCCAGG - Intergenic
1042700780 8:71611564-71611586 AAGACACAAACTTTAAACCATGG + Intergenic
1042708768 8:71691526-71691548 GAGACAGAAACTAAAAATCTTGG + Intergenic
1043379561 8:79688028-79688050 GAGACAGAAACTATAAACCATGG + Intergenic
1044052974 8:87532795-87532817 CAAACAGAAACTCAAAAACGTGG - Intronic
1044170240 8:89042481-89042503 GAGACAGAAACTAAAAACCAAGG - Intergenic
1044364644 8:91329489-91329511 CAGACAGACAATAAAAACCCTGG + Intronic
1045117401 8:98998360-98998382 CTGATAGAAACTAATAACAAAGG + Intergenic
1045680099 8:104649713-104649735 CAGACAGAAAGTAACCACCTGGG - Intronic
1045854025 8:106742286-106742308 CGGACAGAATGTAAAAACAAAGG - Exonic
1046412752 8:113868929-113868951 CAGAGAAAAAATAAAAGCCAAGG - Intergenic
1046493842 8:114987424-114987446 AATAGAAAAACTAAAAACCAAGG + Intergenic
1046496169 8:115016668-115016690 AAGACAGAAATTAAAAAAAATGG - Intergenic
1046510656 8:115198315-115198337 TAGACAGAAAATAAAAGCCTGGG + Intergenic
1047221207 8:122919884-122919906 CACGCAGAAAATAAAAATCATGG + Intronic
1047393377 8:124472541-124472563 GAAACAGAAACTAAAAACCATGG + Intergenic
1048049100 8:130800475-130800497 CAGACTGAAATGAATAACCAGGG - Exonic
1048192076 8:132299077-132299099 AAAAAAGAAACTAAAAACCTTGG - Intronic
1048262794 8:132959888-132959910 AAGACAGAAACTAAAAACCATGG - Intronic
1049094018 8:140537614-140537636 CAGACAAAAATGAAAAACTAAGG - Intronic
1049150718 8:141033899-141033921 CCCACAGATACTAAAATCCAAGG - Intergenic
1050588803 9:7141280-7141302 TAGAGAGAAACTAAAAAGGATGG + Intergenic
1051370966 9:16358716-16358738 GAGACAGAAACTAAAAACCATGG + Intergenic
1051374001 9:16385940-16385962 CATTCAGAAACAAAAAATCAGGG + Intergenic
1051608188 9:18937018-18937040 CAAAGAGAAACCAAAGACCAAGG - Intronic
1051801165 9:20935885-20935907 TAGACAAAACTTAAAAACCATGG - Intronic
1052197600 9:25736443-25736465 CAGGGGGAAACTAAAAAGCATGG + Intergenic
1052252632 9:26416990-26417012 CTGACAGAAAAAAAAAACCTAGG + Intergenic
1052762475 9:32606863-32606885 AAGACATAAACAAAAGACCATGG + Intergenic
1053152892 9:35754214-35754236 AAGACAGAAACTAAGACTCAAGG - Exonic
1053608692 9:39687310-39687332 TAGACAGAAACTAAAAACCATGG + Intergenic
1053866541 9:42443668-42443690 TAGACAGAAACTAAAAACCATGG + Intergenic
1054244832 9:62655100-62655122 TAGACAGAAACTAAAAACCATGG - Intergenic
1054558958 9:66689631-66689653 TAGACAGAAACTAAAAACCATGG - Intergenic
1054936259 9:70691962-70691984 GAGACAGAAACTAAAATCCATGG + Intronic
1055078881 9:72246973-72246995 GAGACAGAAACTAAAAACCATGG + Intronic
1056701764 9:88917152-88917174 GAGACAGAAACTAAAAACCATGG + Intergenic
1056721151 9:89073312-89073334 AAGACAGAAATTGAAAACCAGGG + Intronic
1057167119 9:92937644-92937666 AACACAGAAAATAAAACCCATGG + Intergenic
1057288004 9:93776140-93776162 CAGACTGAAAAGAAAAAACAGGG + Intergenic
1057841629 9:98490099-98490121 CAGACAGAAACTCAGAACAGGGG - Intronic
1058213254 9:102199819-102199841 CAGAAAGAATCTAATAACAAGGG - Intergenic
1058422353 9:104844025-104844047 CAGAAAAAAAAAAAAAACCAGGG + Intronic
1059941651 9:119365925-119365947 CAGGCAGATACTGAAAAACATGG - Intronic
1060278589 9:122200539-122200561 GAGACAGAAACTAAAAACCATGG + Intergenic
1060433739 9:123574725-123574747 GAGAGAGAAACTAAAAGCTATGG + Intronic
1060704397 9:125784826-125784848 CAAACAGAAAGTAAAAACTAAGG - Intronic
1062291224 9:135795817-135795839 CAGATAGAAACTAAGACCAAGGG + Intergenic
1203657563 Un_KI270753v1:13052-13074 CACACAGAAAATAAAAATAAAGG + Intergenic
1185913538 X:4008985-4009007 GAGACAGAAACTAAAATCCATGG - Intergenic
1186509580 X:10120797-10120819 CAGACAGACACTAAGAGCCAAGG - Intronic
1186708894 X:12172227-12172249 GAGACAGAAACTAAAAATCATGG - Intronic
1186844701 X:13519004-13519026 CAGAATGAACGTAAAAACCATGG + Intergenic
1187696168 X:21923421-21923443 AAGACAGAAATTAAAAGACATGG - Intergenic
1188192442 X:27188567-27188589 CAGAAAGAAAATAAAAGGCAAGG - Intergenic
1188277361 X:28216735-28216757 TAAAAAGAAAATAAAAACCAGGG - Intergenic
1188705201 X:33319485-33319507 GAGACAGAAATGAAAAATCAGGG + Intronic
1188815080 X:34703372-34703394 TACACAGAAAATAAAAAGCAAGG - Intergenic
1189191636 X:39113479-39113501 CAAAAAGAAGCTAAAAAGCAAGG - Intergenic
1189599883 X:42612547-42612569 CACACATAAACTAAAAAACCTGG - Intergenic
1189873950 X:45415278-45415300 CACACAGAAACTGAAAATAAAGG - Intergenic
1190052579 X:47161835-47161857 CAAACAAAAACAAAAAACAAAGG - Intronic
1190583759 X:51916419-51916441 CAGAGAGAAACAAAAAACAGAGG - Intergenic
1190716847 X:53111777-53111799 GATACAGAAACTAAAAACCGTGG + Intergenic
1191906110 X:66092315-66092337 AAAACAAAAACAAAAAACCAAGG - Intergenic
1193432046 X:81419824-81419846 AAGACAACAACTAAAAACAAAGG + Intergenic
1193447647 X:81623803-81623825 CACACAGAGACTAAGAACAAAGG - Intergenic
1194131957 X:90092487-90092509 CAAACAGAAAGTAAAAAGCATGG - Intergenic
1194937382 X:99967668-99967690 CACACATAGACTAAAAACAAAGG - Intergenic
1195804611 X:108749663-108749685 CAGAGAGGAAATAATAACCAAGG - Intergenic
1196530847 X:116784487-116784509 AAAACAAAAACAAAAAACCAAGG + Intergenic
1196723672 X:118877588-118877610 GAGAGAGAAAAAAAAAACCAGGG - Intergenic
1198119913 X:133582011-133582033 CAGGAAGAAACTACAAATCAGGG - Intronic
1198481406 X:137044793-137044815 CAGAGGCAAACTAAAAATCAGGG - Intergenic
1198777389 X:140194804-140194826 CTGACAGAAACAAAAATCCTTGG - Intergenic
1199051687 X:143243503-143243525 CAAAAAGAAAATAAAACCCAAGG + Intergenic
1200113774 X:153759988-153760010 AAAACAGAAAATAAAAAACAAGG + Intergenic
1200887901 Y:8288853-8288875 GAGACAGAAACTAAAAAGTATGG - Intergenic