ID: 1067605771

View in Genome Browser
Species Human (GRCh38)
Location 10:47661138-47661160
Sequence GTGGAAAGGAGGGATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067605764_1067605771 16 Left 1067605764 10:47661099-47661121 CCTGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG No data
1067605765_1067605771 9 Left 1067605765 10:47661106-47661128 CCATGGTTTTTAGTTTCTGTCTG 0: 4
1: 66
2: 70
3: 61
4: 495
Right 1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067605771 Original CRISPR GTGGAAAGGAGGGATGAGGA AGG Intergenic
No off target data available for this crispr