ID: 1067609183

View in Genome Browser
Species Human (GRCh38)
Location 10:47694916-47694938
Sequence CAGAATAAGGACTAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067609179_1067609183 -2 Left 1067609179 10:47694895-47694917 CCACAGTGTTTAAAGGACAAACA No data
Right 1067609183 10:47694916-47694938 CAGAATAAGGACTAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067609183 Original CRISPR CAGAATAAGGACTAGGAGCT GGG Intergenic
No off target data available for this crispr