ID: 1067612474

View in Genome Browser
Species Human (GRCh38)
Location 10:47731562-47731584
Sequence CAGTCTCTCTAGATACAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067612474_1067612476 -2 Left 1067612474 10:47731562-47731584 CCATTTTGTATCTAGAGAGACTG No data
Right 1067612476 10:47731583-47731605 TGGAATTCAAACAAAATCATTGG No data
1067612474_1067612478 23 Left 1067612474 10:47731562-47731584 CCATTTTGTATCTAGAGAGACTG No data
Right 1067612478 10:47731608-47731630 CCCTTCAATGATTCGTTGAATGG No data
1067612474_1067612480 24 Left 1067612474 10:47731562-47731584 CCATTTTGTATCTAGAGAGACTG No data
Right 1067612480 10:47731609-47731631 CCTTCAATGATTCGTTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067612474 Original CRISPR CAGTCTCTCTAGATACAAAA TGG (reversed) Intergenic
No off target data available for this crispr