ID: 1067615440

View in Genome Browser
Species Human (GRCh38)
Location 10:47756922-47756944
Sequence TGTTTCCCGAGGCAGCGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067615440_1067615455 26 Left 1067615440 10:47756922-47756944 CCAAGACGCTGCCTCGGGAAACA No data
Right 1067615455 10:47756971-47756993 TGGGTTAGAACCCTCCGTAGGGG 0: 2
1: 0
2: 0
3: 0
4: 44
1067615440_1067615454 25 Left 1067615440 10:47756922-47756944 CCAAGACGCTGCCTCGGGAAACA No data
Right 1067615454 10:47756970-47756992 CTGGGTTAGAACCCTCCGTAGGG 0: 2
1: 0
2: 0
3: 1
4: 42
1067615440_1067615448 -6 Left 1067615440 10:47756922-47756944 CCAAGACGCTGCCTCGGGAAACA No data
Right 1067615448 10:47756939-47756961 GAAACAGGAGGGGCAGGGCCTGG 0: 2
1: 0
2: 12
3: 141
4: 1118
1067615440_1067615451 7 Left 1067615440 10:47756922-47756944 CCAAGACGCTGCCTCGGGAAACA No data
Right 1067615451 10:47756952-47756974 CAGGGCCTGGTATTGCGGCTGGG No data
1067615440_1067615450 6 Left 1067615440 10:47756922-47756944 CCAAGACGCTGCCTCGGGAAACA No data
Right 1067615450 10:47756951-47756973 GCAGGGCCTGGTATTGCGGCTGG 0: 2
1: 0
2: 0
3: 11
4: 148
1067615440_1067615449 2 Left 1067615440 10:47756922-47756944 CCAAGACGCTGCCTCGGGAAACA No data
Right 1067615449 10:47756947-47756969 AGGGGCAGGGCCTGGTATTGCGG 0: 2
1: 0
2: 2
3: 51
4: 475
1067615440_1067615453 24 Left 1067615440 10:47756922-47756944 CCAAGACGCTGCCTCGGGAAACA No data
Right 1067615453 10:47756969-47756991 GCTGGGTTAGAACCCTCCGTAGG 0: 2
1: 0
2: 0
3: 4
4: 50
1067615440_1067615456 29 Left 1067615440 10:47756922-47756944 CCAAGACGCTGCCTCGGGAAACA No data
Right 1067615456 10:47756974-47756996 GTTAGAACCCTCCGTAGGGGAGG 0: 2
1: 0
2: 0
3: 0
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067615440 Original CRISPR TGTTTCCCGAGGCAGCGTCT TGG (reversed) Intergenic
No off target data available for this crispr