ID: 1067620158

View in Genome Browser
Species Human (GRCh38)
Location 10:47875843-47875865
Sequence CTGTAAATGCTGATGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067620158_1067620161 -3 Left 1067620158 10:47875843-47875865 CCCAGCCTCATCAGCATTTACAG No data
Right 1067620161 10:47875863-47875885 CAGAGCACTTACTGTGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067620158 Original CRISPR CTGTAAATGCTGATGAGGCT GGG (reversed) Intergenic
No off target data available for this crispr