ID: 1067620303

View in Genome Browser
Species Human (GRCh38)
Location 10:47877385-47877407
Sequence ATATATATGTAATAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067620303_1067620308 -5 Left 1067620303 10:47877385-47877407 CCATCCACCTATTACATATATAT No data
Right 1067620308 10:47877403-47877425 TATATACAGTGGGTGTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067620303 Original CRISPR ATATATATGTAATAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr