ID: 1067626473

View in Genome Browser
Species Human (GRCh38)
Location 10:47928303-47928325
Sequence TCTAAGGTATGTGGAAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067626473_1067626483 28 Left 1067626473 10:47928303-47928325 CCTAAATTTCCACATACCTTAGA No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data
1067626473_1067626475 -9 Left 1067626473 10:47928303-47928325 CCTAAATTTCCACATACCTTAGA No data
Right 1067626475 10:47928317-47928339 TACCTTAGAGAAACACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067626473 Original CRISPR TCTAAGGTATGTGGAAATTT AGG (reversed) Intergenic
No off target data available for this crispr