ID: 1067626476

View in Genome Browser
Species Human (GRCh38)
Location 10:47928319-47928341
Sequence GACCTGGGGGTGTTTCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067626476_1067626483 12 Left 1067626476 10:47928319-47928341 CCTTAGAGAAACACCCCCAGGTC No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067626476 Original CRISPR GACCTGGGGGTGTTTCTCTA AGG (reversed) Intergenic
No off target data available for this crispr