ID: 1067626478

View in Genome Browser
Species Human (GRCh38)
Location 10:47928333-47928355
Sequence AGTCACAGTGGTAGGACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067626478_1067626487 17 Left 1067626478 10:47928333-47928355 CCCCAGGTCCTACCACTGTGACT No data
Right 1067626487 10:47928373-47928395 CTGGAAGAAACTGAAGTCACCGG No data
1067626478_1067626483 -2 Left 1067626478 10:47928333-47928355 CCCCAGGTCCTACCACTGTGACT No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067626478 Original CRISPR AGTCACAGTGGTAGGACCTG GGG (reversed) Intergenic
No off target data available for this crispr