ID: 1067626480

View in Genome Browser
Species Human (GRCh38)
Location 10:47928335-47928357
Sequence AGAGTCACAGTGGTAGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067626480_1067626483 -4 Left 1067626480 10:47928335-47928357 CCAGGTCCTACCACTGTGACTCT No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data
1067626480_1067626487 15 Left 1067626480 10:47928335-47928357 CCAGGTCCTACCACTGTGACTCT No data
Right 1067626487 10:47928373-47928395 CTGGAAGAAACTGAAGTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067626480 Original CRISPR AGAGTCACAGTGGTAGGACC TGG (reversed) Intergenic
No off target data available for this crispr