ID: 1067626483

View in Genome Browser
Species Human (GRCh38)
Location 10:47928354-47928376
Sequence CTCTCTGTCCACCCTGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067626474_1067626483 19 Left 1067626474 10:47928312-47928334 CCACATACCTTAGAGAAACACCC No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data
1067626479_1067626483 -3 Left 1067626479 10:47928334-47928356 CCCAGGTCCTACCACTGTGACTC No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data
1067626473_1067626483 28 Left 1067626473 10:47928303-47928325 CCTAAATTTCCACATACCTTAGA No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data
1067626481_1067626483 -10 Left 1067626481 10:47928341-47928363 CCTACCACTGTGACTCTCTGTCC No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data
1067626478_1067626483 -2 Left 1067626478 10:47928333-47928355 CCCCAGGTCCTACCACTGTGACT No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data
1067626480_1067626483 -4 Left 1067626480 10:47928335-47928357 CCAGGTCCTACCACTGTGACTCT No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data
1067626476_1067626483 12 Left 1067626476 10:47928319-47928341 CCTTAGAGAAACACCCCCAGGTC No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data
1067626477_1067626483 -1 Left 1067626477 10:47928332-47928354 CCCCCAGGTCCTACCACTGTGAC No data
Right 1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067626483 Original CRISPR CTCTCTGTCCACCCTGATAC TGG Intergenic
No off target data available for this crispr