ID: 1067626892

View in Genome Browser
Species Human (GRCh38)
Location 10:47931368-47931390
Sequence AAGAATATGGGGAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067626887_1067626892 -8 Left 1067626887 10:47931353-47931375 CCAGGGAACAAGATGAAGAATAT No data
Right 1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG No data
1067626886_1067626892 -7 Left 1067626886 10:47931352-47931374 CCCAGGGAACAAGATGAAGAATA No data
Right 1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG No data
1067626883_1067626892 13 Left 1067626883 10:47931332-47931354 CCTTTATTAGGGAGAAAGATCCC No data
Right 1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067626892 Original CRISPR AAGAATATGGGGAAGGAGAC AGG Intergenic
No off target data available for this crispr