ID: 1067631365

View in Genome Browser
Species Human (GRCh38)
Location 10:47965905-47965927
Sequence CTCCCTCTCCTCCCTGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067631365_1067631368 -10 Left 1067631365 10:47965905-47965927 CCGGCCTCAGGGAGGAGAGGGAG No data
Right 1067631368 10:47965918-47965940 GGAGAGGGAGACGGTGATCATGG No data
1067631365_1067631377 20 Left 1067631365 10:47965905-47965927 CCGGCCTCAGGGAGGAGAGGGAG No data
Right 1067631377 10:47965948-47965970 GCCCTGGGAGTGAGAAGCTGGGG No data
1067631365_1067631375 18 Left 1067631365 10:47965905-47965927 CCGGCCTCAGGGAGGAGAGGGAG No data
Right 1067631375 10:47965946-47965968 AGGCCCTGGGAGTGAGAAGCTGG No data
1067631365_1067631374 5 Left 1067631365 10:47965905-47965927 CCGGCCTCAGGGAGGAGAGGGAG No data
Right 1067631374 10:47965933-47965955 GATCATGGAGGGGAGGCCCTGGG No data
1067631365_1067631379 21 Left 1067631365 10:47965905-47965927 CCGGCCTCAGGGAGGAGAGGGAG No data
Right 1067631379 10:47965949-47965971 CCCTGGGAGTGAGAAGCTGGGGG No data
1067631365_1067631371 -5 Left 1067631365 10:47965905-47965927 CCGGCCTCAGGGAGGAGAGGGAG No data
Right 1067631371 10:47965923-47965945 GGGAGACGGTGATCATGGAGGGG No data
1067631365_1067631372 -2 Left 1067631365 10:47965905-47965927 CCGGCCTCAGGGAGGAGAGGGAG No data
Right 1067631372 10:47965926-47965948 AGACGGTGATCATGGAGGGGAGG No data
1067631365_1067631373 4 Left 1067631365 10:47965905-47965927 CCGGCCTCAGGGAGGAGAGGGAG No data
Right 1067631373 10:47965932-47965954 TGATCATGGAGGGGAGGCCCTGG No data
1067631365_1067631370 -6 Left 1067631365 10:47965905-47965927 CCGGCCTCAGGGAGGAGAGGGAG No data
Right 1067631370 10:47965922-47965944 AGGGAGACGGTGATCATGGAGGG No data
1067631365_1067631369 -7 Left 1067631365 10:47965905-47965927 CCGGCCTCAGGGAGGAGAGGGAG No data
Right 1067631369 10:47965921-47965943 GAGGGAGACGGTGATCATGGAGG No data
1067631365_1067631376 19 Left 1067631365 10:47965905-47965927 CCGGCCTCAGGGAGGAGAGGGAG No data
Right 1067631376 10:47965947-47965969 GGCCCTGGGAGTGAGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067631365 Original CRISPR CTCCCTCTCCTCCCTGAGGC CGG (reversed) Intergenic
No off target data available for this crispr