ID: 1067634397

View in Genome Browser
Species Human (GRCh38)
Location 10:47991661-47991683
Sequence CTGGGTAAGTGGGAGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067634397_1067634402 -10 Left 1067634397 10:47991661-47991683 CCTGCCAGCTCCCACTTACCCAG No data
Right 1067634402 10:47991674-47991696 ACTTACCCAGGCTTTCCACCAGG 0: 2
1: 1
2: 0
3: 8
4: 103
1067634397_1067634412 25 Left 1067634397 10:47991661-47991683 CCTGCCAGCTCCCACTTACCCAG No data
Right 1067634412 10:47991709-47991731 CTTCGGGGGCACCTTTCTCACGG No data
1067634397_1067634408 9 Left 1067634397 10:47991661-47991683 CCTGCCAGCTCCCACTTACCCAG No data
Right 1067634408 10:47991693-47991715 CAGGCCATCTCTTTCACTTCGGG No data
1067634397_1067634407 8 Left 1067634397 10:47991661-47991683 CCTGCCAGCTCCCACTTACCCAG No data
Right 1067634407 10:47991692-47991714 CCAGGCCATCTCTTTCACTTCGG No data
1067634397_1067634410 11 Left 1067634397 10:47991661-47991683 CCTGCCAGCTCCCACTTACCCAG No data
Right 1067634410 10:47991695-47991717 GGCCATCTCTTTCACTTCGGGGG No data
1067634397_1067634409 10 Left 1067634397 10:47991661-47991683 CCTGCCAGCTCCCACTTACCCAG No data
Right 1067634409 10:47991694-47991716 AGGCCATCTCTTTCACTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067634397 Original CRISPR CTGGGTAAGTGGGAGCTGGC AGG (reversed) Intergenic
No off target data available for this crispr