ID: 1067634402

View in Genome Browser
Species Human (GRCh38)
Location 10:47991674-47991696
Sequence ACTTACCCAGGCTTTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 2, 1: 1, 2: 0, 3: 8, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067634396_1067634402 -2 Left 1067634396 10:47991653-47991675 CCAAATCTCCTGCCAGCTCCCAC No data
Right 1067634402 10:47991674-47991696 ACTTACCCAGGCTTTCCACCAGG 0: 2
1: 1
2: 0
3: 8
4: 103
1067634393_1067634402 16 Left 1067634393 10:47991635-47991657 CCAACACCATGCAGGAACCCAAA No data
Right 1067634402 10:47991674-47991696 ACTTACCCAGGCTTTCCACCAGG 0: 2
1: 1
2: 0
3: 8
4: 103
1067634392_1067634402 17 Left 1067634392 10:47991634-47991656 CCCAACACCATGCAGGAACCCAA No data
Right 1067634402 10:47991674-47991696 ACTTACCCAGGCTTTCCACCAGG 0: 2
1: 1
2: 0
3: 8
4: 103
1067634391_1067634402 23 Left 1067634391 10:47991628-47991650 CCAGCACCCAACACCATGCAGGA No data
Right 1067634402 10:47991674-47991696 ACTTACCCAGGCTTTCCACCAGG 0: 2
1: 1
2: 0
3: 8
4: 103
1067634394_1067634402 10 Left 1067634394 10:47991641-47991663 CCATGCAGGAACCCAAATCTCCT No data
Right 1067634402 10:47991674-47991696 ACTTACCCAGGCTTTCCACCAGG 0: 2
1: 1
2: 0
3: 8
4: 103
1067634395_1067634402 -1 Left 1067634395 10:47991652-47991674 CCCAAATCTCCTGCCAGCTCCCA No data
Right 1067634402 10:47991674-47991696 ACTTACCCAGGCTTTCCACCAGG 0: 2
1: 1
2: 0
3: 8
4: 103
1067634397_1067634402 -10 Left 1067634397 10:47991661-47991683 CCTGCCAGCTCCCACTTACCCAG No data
Right 1067634402 10:47991674-47991696 ACTTACCCAGGCTTTCCACCAGG 0: 2
1: 1
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067634402 Original CRISPR ACTTACCCAGGCTTTCCACC AGG Intergenic
902280664 1:15371872-15371894 GCTTGCCCTGGCTTTCCAGCTGG - Intronic
902404983 1:16177605-16177627 ACTTACCCTGACTTTACTCCTGG - Intergenic
906126424 1:43429841-43429863 CCTCACCCAAGCTTCCCACCTGG - Exonic
911097974 1:94070781-94070803 ACTGCCCCAGGCTTCCCACCTGG - Intronic
911556188 1:99347504-99347526 ACTTAGCAAGGCTGGCCACCAGG - Intergenic
917803029 1:178587440-178587462 CCTTACCCAGGCTTTACAGCTGG + Intergenic
918390990 1:184061793-184061815 ACTTTCCCAGGCTTTAGACCTGG + Intronic
920265820 1:204721858-204721880 AATTATCCGGGCTTTCCAACTGG + Intergenic
923402674 1:233629898-233629920 ACTCACCCAGGCTTTCTAGTCGG - Intronic
924749458 1:246872275-246872297 ACTAACCCAAGCTGTCCAGCTGG + Intronic
1067449903 10:46375856-46375878 ACTTACCCAGGCTTTCCACCAGG - Exonic
1067587343 10:47483907-47483929 ACTTACCCAGGATTTCCACCAGG + Exonic
1067634402 10:47991674-47991696 ACTTACCCAGGCTTTCCACCAGG + Intergenic
1072303615 10:94085822-94085844 ACTTACCCAGTCTGTCTTCCAGG - Intronic
1073615458 10:104990584-104990606 AACTCCCCAGGCTGTCCACCTGG + Intronic
1074105080 10:110383275-110383297 CCTCACCCTGGCTTTCCTCCTGG + Intergenic
1077410509 11:2401745-2401767 ACATACCCTGCCTTTCCAGCTGG - Intronic
1079371310 11:19855359-19855381 AATTCCCTAGACTTTCCACCTGG + Intronic
1080885129 11:36360706-36360728 ACTTACACAGATTTTCCCCCTGG - Intronic
1084069331 11:66724070-66724092 ACTTACCAAGGCTAGCCCCCAGG + Intronic
1085702250 11:78755684-78755706 ATTTACCCAGGCATTCAAGCGGG + Intronic
1091815951 12:3438083-3438105 ACTTCCCCAGGCTCCCCACTCGG - Intronic
1091946436 12:4548815-4548837 ACTGAACCAGACTTTGCACCTGG + Exonic
1092058469 12:5526028-5526050 ACTTTCCCAGGCTTATCTCCAGG + Intergenic
1092334901 12:7623453-7623475 ACTCACCCAGGATGTCCAGCTGG - Intergenic
1092934037 12:13343372-13343394 TCTCACCCAGGATGTCCACCAGG - Intergenic
1103983896 12:124754685-124754707 AGCTAGCCAGGCTTTCCACAAGG - Intergenic
1107436623 13:40386030-40386052 ACCTGCCCAGGGATTCCACCAGG + Intergenic
1108269814 13:48748675-48748697 GCATACCCAGGCTTCCCCCCAGG + Intergenic
1108584400 13:51856530-51856552 AGTTACCCAGGCTTACACCCAGG + Intergenic
1109572075 13:64206486-64206508 ACTTACCCACTCATCCCACCAGG + Intergenic
1109740703 13:66551022-66551044 ACTTTCACAAGCTTTCCAGCTGG + Intronic
1119758311 14:77134013-77134035 ATCTAGGCAGGCTTTCCACCGGG + Intronic
1120215455 14:81677158-81677180 ACTTATCCCCGCTTTCCACTGGG - Intergenic
1122692223 14:103536801-103536823 ACTCACCCAGGGCTGCCACCAGG - Exonic
1126416235 15:48420539-48420561 ACTTACCTCGGGTTTCAACCAGG + Intronic
1127377832 15:58401499-58401521 AGTTACTCAGGCTTGCCATCTGG - Intronic
1129275324 15:74441670-74441692 GCTTACCCAGCCTCTCCAGCAGG - Intergenic
1131310978 15:91289687-91289709 TCTTCCCCAGGCTTTCCTCAGGG + Intronic
1131983474 15:98017996-98018018 ACTTATCCAAGGCTTCCACCTGG - Intergenic
1140446383 16:75031867-75031889 AGTTACCCAGCATTTCTACCGGG - Intronic
1140459883 16:75131132-75131154 TATTCTCCAGGCTTTCCACCTGG + Intergenic
1145804498 17:27716869-27716891 ACTTACCCAGGCCTTAGAACTGG + Intergenic
1146376514 17:32298329-32298351 ACTTAACCAGGCTGTCCTCCAGG + Intronic
1147160727 17:38568121-38568143 CCTTGCACAGGCTTTGCACCGGG - Intronic
1148075741 17:44934376-44934398 ACTGACCCAGGCTGTCCAGGTGG - Exonic
1148751985 17:49950621-49950643 ACTCACCCTGGCTTTCCCCTTGG - Intergenic
1149480466 17:56999360-56999382 ACTTAACCAAGATTTCTACCTGG - Intronic
1152686686 17:81697151-81697173 ACTCACACAGGCTTTCCTGCTGG + Intronic
1153301478 18:3595740-3595762 ATTTTCCCAGCCTTTCCAACAGG + Intronic
1159005953 18:63011887-63011909 ACTTACCCATGTTTTCCTCTGGG + Intergenic
1163439390 19:17314087-17314109 ACTCACCGAGGCTTTGCACACGG - Exonic
1164752532 19:30667336-30667358 ACTAACCCAGCTTTTCCACCAGG - Intronic
1166163690 19:40971216-40971238 CCTCAGCCAGGCTTGCCACCTGG + Intergenic
1168686271 19:58351309-58351331 ACTTCCCCAGACTCTACACCTGG + Intronic
926335433 2:11859218-11859240 ACTTCTCCAGGGTTCCCACCAGG - Intergenic
931443220 2:62305837-62305859 GCTTGCCCTGGCTTTCCCCCAGG - Intergenic
933249551 2:80013656-80013678 ATTTACCCAGTCATTTCACCAGG + Intronic
937211815 2:120278507-120278529 ACTAACCCAGACATTCCAACAGG - Intronic
942690573 2:178580809-178580831 GCTTAACCAGGTTTTCCCCCCGG + Intronic
943324462 2:186481220-186481242 ACTTGCCCATGCTTGCCACCTGG + Intergenic
948450165 2:238064425-238064447 ATTTCCCCAGGCTTCCCACATGG - Exonic
1170215009 20:13882492-13882514 ACTGGCCCAAGCTTTCCACATGG - Intronic
1170339680 20:15310172-15310194 TCTTTCCCAGGCTTTCTGCCAGG - Intronic
1172325684 20:34032711-34032733 ATTTGCCCAGGGTTTACACCTGG + Intronic
1172895001 20:38294275-38294297 AGTTACCTGGGTTTTCCACCAGG + Intronic
1174414952 20:50360331-50360353 TCTTGCCCAGGCTGTGCACCAGG - Intergenic
1181996265 22:26885302-26885324 AGTTAGGCAGGCTGTCCACCTGG - Intergenic
1184214979 22:43060611-43060633 ACTTGGCCAAGCTTTCCTCCTGG + Intronic
1184761649 22:46548112-46548134 ACTCACCCAAGCTCCCCACCAGG - Intergenic
1184860223 22:47169277-47169299 AGTTGCTCACGCTTTCCACCAGG - Intronic
954371791 3:50172801-50172823 TCTTACCCTGGCTGCCCACCAGG - Intronic
955130024 3:56157089-56157111 ACTTGCCCAAGGTTTCCCCCTGG + Intronic
956251082 3:67234857-67234879 ACATCCCCAGGCTGTCCACCTGG + Intergenic
964538682 3:157755471-157755493 TATCACCAAGGCTTTCCACCAGG + Intergenic
966481528 3:180414177-180414199 GATTACCCAGGCCTTGCACCTGG + Intergenic
969882616 4:10187613-10187635 ACCTGCCCACTCTTTCCACCTGG - Intergenic
971137301 4:23883158-23883180 ACTTTCCCAGGCTTCTCAGCCGG - Intronic
974647624 4:64715325-64715347 TCTTCACCAGGCTTTTCACCTGG - Intergenic
975451411 4:74531191-74531213 ACTCACCCAAGGTTACCACCAGG - Intergenic
975858708 4:78652838-78652860 ACTTACCCAGGCACTCAACCAGG + Intergenic
981712563 4:147723672-147723694 ACTTTACCATGATTTCCACCGGG - Intergenic
984888517 4:184472821-184472843 ACTGACCCGGGCGTTTCACCTGG + Intronic
986073720 5:4313002-4313024 TCTTACCCCGGCTCTCCTCCTGG - Intergenic
990754112 5:59049119-59049141 TCTTAGCCAATCTTTCCACCTGG + Intronic
991167153 5:63576829-63576851 TCCTACCCAGTCCTTCCACCCGG + Intergenic
993275622 5:85853056-85853078 ACTTTCCCAGTCTTGCCACTTGG + Intergenic
996399290 5:123043722-123043744 ACTTACCCAGGCTGGGCACTGGG + Intergenic
1002695884 5:181088236-181088258 TCTCAGCCAGGCTTTCCACTAGG + Intergenic
1002795256 6:466491-466513 TCCTACCCATGCTTTCCAACAGG - Intergenic
1007702719 6:43773973-43773995 ACTTACCATGGCTTTGGACCAGG + Intronic
1007805793 6:44444894-44444916 ACTTTCCAAGCCTTTCCCCCTGG - Intronic
1009434355 6:63600995-63601017 TCTTACCCTGGGTTTTCACCTGG - Intergenic
1013442387 6:110183464-110183486 CCTTACGCAGCCTTTCCTCCTGG - Intronic
1016137800 6:140567655-140567677 TCTTAGCCAGGGTTTCCACAGGG - Intergenic
1017989529 6:159473881-159473903 CCTTACCCAGCCTTTCCAAAAGG + Intergenic
1023733160 7:43210990-43211012 ACAAACCCAGGCATTCCAGCCGG - Intronic
1024131213 7:46354700-46354722 ACTTGCCCATGCTGTTCACCAGG + Intergenic
1025255535 7:57381859-57381881 TCTTGCCCAGGCTATACACCAGG + Intergenic
1026859031 7:73773106-73773128 GCCTACCCAGGCTTTCCTACTGG + Intergenic
1031112473 7:117628940-117628962 ATTTATCAAGGCTTTCTACCAGG - Intronic
1037209451 8:16368225-16368247 GTTTACCCAGTCTGTCCACCTGG - Intronic
1045252370 8:100492659-100492681 ACTCACCCAGGCATTTCTCCAGG - Intergenic
1047224030 8:122941825-122941847 ACATTCCCAGGCTCTGCACCTGG + Intronic
1048894881 8:138982862-138982884 ATTTACCCATGCTTTCTCCCTGG - Intergenic
1049850631 8:144828223-144828245 ACCTGCCCAGGCATTCCCCCGGG - Intronic
1051307242 9:15724946-15724968 GCTTTCCCAGGCTTTCCATAAGG + Exonic
1056839473 9:89986878-89986900 AGCAACCCAGGCTCTCCACCAGG + Intergenic
1057867178 9:98690860-98690882 ACTTCCCCAGGCTGTCCCTCTGG - Intronic
1061515245 9:131085958-131085980 ACTTAACCAGGACTTACACCTGG + Intronic
1188075301 X:25768478-25768500 ACTAACTCAGTCTTTCCCCCAGG - Intergenic
1190579015 X:51872394-51872416 TCTATGCCAGGCTTTCCACCAGG + Intronic
1192599971 X:72451868-72451890 TTTCACCCAGGCTTTCTACCTGG + Intronic
1195497608 X:105555332-105555354 AGTTACCTTAGCTTTCCACCTGG - Intronic