ID: 1067634409

View in Genome Browser
Species Human (GRCh38)
Location 10:47991694-47991716
Sequence AGGCCATCTCTTTCACTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067634396_1067634409 18 Left 1067634396 10:47991653-47991675 CCAAATCTCCTGCCAGCTCCCAC No data
Right 1067634409 10:47991694-47991716 AGGCCATCTCTTTCACTTCGGGG No data
1067634403_1067634409 -8 Left 1067634403 10:47991679-47991701 CCCAGGCTTTCCACCAGGCCATC No data
Right 1067634409 10:47991694-47991716 AGGCCATCTCTTTCACTTCGGGG No data
1067634400_1067634409 0 Left 1067634400 10:47991671-47991693 CCCACTTACCCAGGCTTTCCACC No data
Right 1067634409 10:47991694-47991716 AGGCCATCTCTTTCACTTCGGGG No data
1067634394_1067634409 30 Left 1067634394 10:47991641-47991663 CCATGCAGGAACCCAAATCTCCT No data
Right 1067634409 10:47991694-47991716 AGGCCATCTCTTTCACTTCGGGG No data
1067634399_1067634409 6 Left 1067634399 10:47991665-47991687 CCAGCTCCCACTTACCCAGGCTT No data
Right 1067634409 10:47991694-47991716 AGGCCATCTCTTTCACTTCGGGG No data
1067634397_1067634409 10 Left 1067634397 10:47991661-47991683 CCTGCCAGCTCCCACTTACCCAG No data
Right 1067634409 10:47991694-47991716 AGGCCATCTCTTTCACTTCGGGG No data
1067634404_1067634409 -9 Left 1067634404 10:47991680-47991702 CCAGGCTTTCCACCAGGCCATCT No data
Right 1067634409 10:47991694-47991716 AGGCCATCTCTTTCACTTCGGGG No data
1067634395_1067634409 19 Left 1067634395 10:47991652-47991674 CCCAAATCTCCTGCCAGCTCCCA No data
Right 1067634409 10:47991694-47991716 AGGCCATCTCTTTCACTTCGGGG No data
1067634401_1067634409 -1 Left 1067634401 10:47991672-47991694 CCACTTACCCAGGCTTTCCACCA No data
Right 1067634409 10:47991694-47991716 AGGCCATCTCTTTCACTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067634409 Original CRISPR AGGCCATCTCTTTCACTTCG GGG Intergenic
No off target data available for this crispr