ID: 1067634412

View in Genome Browser
Species Human (GRCh38)
Location 10:47991709-47991731
Sequence CTTCGGGGGCACCTTTCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067634400_1067634412 15 Left 1067634400 10:47991671-47991693 CCCACTTACCCAGGCTTTCCACC No data
Right 1067634412 10:47991709-47991731 CTTCGGGGGCACCTTTCTCACGG No data
1067634397_1067634412 25 Left 1067634397 10:47991661-47991683 CCTGCCAGCTCCCACTTACCCAG No data
Right 1067634412 10:47991709-47991731 CTTCGGGGGCACCTTTCTCACGG No data
1067634399_1067634412 21 Left 1067634399 10:47991665-47991687 CCAGCTCCCACTTACCCAGGCTT No data
Right 1067634412 10:47991709-47991731 CTTCGGGGGCACCTTTCTCACGG No data
1067634406_1067634412 -6 Left 1067634406 10:47991692-47991714 CCAGGCCATCTCTTTCACTTCGG No data
Right 1067634412 10:47991709-47991731 CTTCGGGGGCACCTTTCTCACGG No data
1067634404_1067634412 6 Left 1067634404 10:47991680-47991702 CCAGGCTTTCCACCAGGCCATCT No data
Right 1067634412 10:47991709-47991731 CTTCGGGGGCACCTTTCTCACGG No data
1067634405_1067634412 -3 Left 1067634405 10:47991689-47991711 CCACCAGGCCATCTCTTTCACTT No data
Right 1067634412 10:47991709-47991731 CTTCGGGGGCACCTTTCTCACGG No data
1067634403_1067634412 7 Left 1067634403 10:47991679-47991701 CCCAGGCTTTCCACCAGGCCATC No data
Right 1067634412 10:47991709-47991731 CTTCGGGGGCACCTTTCTCACGG No data
1067634401_1067634412 14 Left 1067634401 10:47991672-47991694 CCACTTACCCAGGCTTTCCACCA No data
Right 1067634412 10:47991709-47991731 CTTCGGGGGCACCTTTCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067634412 Original CRISPR CTTCGGGGGCACCTTTCTCA CGG Intergenic
No off target data available for this crispr