ID: 1067642244

View in Genome Browser
Species Human (GRCh38)
Location 10:48058784-48058806
Sequence GCCTCATTCGGAACTTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067642244_1067642247 10 Left 1067642244 10:48058784-48058806 CCAGGTGAAGTTCCGAATGAGGC No data
Right 1067642247 10:48058817-48058839 AGTGCTCTTTCCAACTTTGGAGG No data
1067642244_1067642246 7 Left 1067642244 10:48058784-48058806 CCAGGTGAAGTTCCGAATGAGGC No data
Right 1067642246 10:48058814-48058836 CAAAGTGCTCTTTCCAACTTTGG No data
1067642244_1067642249 28 Left 1067642244 10:48058784-48058806 CCAGGTGAAGTTCCGAATGAGGC No data
Right 1067642249 10:48058835-48058857 GGAGGCCCCGTCACCACTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067642244 Original CRISPR GCCTCATTCGGAACTTCACC TGG (reversed) Intergenic