ID: 1067642247

View in Genome Browser
Species Human (GRCh38)
Location 10:48058817-48058839
Sequence AGTGCTCTTTCCAACTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067642245_1067642247 -2 Left 1067642245 10:48058796-48058818 CCGAATGAGGCATTATATCAAAG No data
Right 1067642247 10:48058817-48058839 AGTGCTCTTTCCAACTTTGGAGG No data
1067642244_1067642247 10 Left 1067642244 10:48058784-48058806 CCAGGTGAAGTTCCGAATGAGGC No data
Right 1067642247 10:48058817-48058839 AGTGCTCTTTCCAACTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067642247 Original CRISPR AGTGCTCTTTCCAACTTTGG AGG Intergenic