ID: 1067643278

View in Genome Browser
Species Human (GRCh38)
Location 10:48071313-48071335
Sequence AACAGCTTTTGGCCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067643278_1067643282 5 Left 1067643278 10:48071313-48071335 CCAGTAGCAGGCCAAAAGCTGTT No data
Right 1067643282 10:48071341-48071363 AAAAGAGAGTCCAGAGAGGGTGG 0: 2
1: 0
2: 11
3: 71
4: 880
1067643278_1067643280 1 Left 1067643278 10:48071313-48071335 CCAGTAGCAGGCCAAAAGCTGTT No data
Right 1067643280 10:48071337-48071359 CTCAAAAAGAGAGTCCAGAGAGG 0: 2
1: 0
2: 2
3: 27
4: 297
1067643278_1067643281 2 Left 1067643278 10:48071313-48071335 CCAGTAGCAGGCCAAAAGCTGTT No data
Right 1067643281 10:48071338-48071360 TCAAAAAGAGAGTCCAGAGAGGG 0: 2
1: 0
2: 1
3: 31
4: 349
1067643278_1067643283 9 Left 1067643278 10:48071313-48071335 CCAGTAGCAGGCCAAAAGCTGTT No data
Right 1067643283 10:48071345-48071367 GAGAGTCCAGAGAGGGTGGCAGG 0: 2
1: 0
2: 6
3: 41
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067643278 Original CRISPR AACAGCTTTTGGCCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr