ID: 1067646238

View in Genome Browser
Species Human (GRCh38)
Location 10:48106676-48106698
Sequence AGGAAGCTGCAGAAGATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067646238_1067646242 12 Left 1067646238 10:48106676-48106698 CCTCTCATCTTCTGCAGCTTCCT No data
Right 1067646242 10:48106711-48106733 CACATACACCCTACGACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067646238 Original CRISPR AGGAAGCTGCAGAAGATGAG AGG (reversed) Intergenic
No off target data available for this crispr