ID: 1067647650

View in Genome Browser
Species Human (GRCh38)
Location 10:48124328-48124350
Sequence GTCACATATGTAAATTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 2, 1: 0, 2: 2, 3: 27, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067647650 Original CRISPR GTCACATATGTAAATTCAGG GGG Intergenic
900711520 1:4117727-4117749 CTCACATATGTAAATCCATGTGG - Intergenic
901507466 1:9694204-9694226 GTCACATATTGACATTGAGGGGG + Intronic
903196710 1:21694980-21695002 TACATATATGTAAATACAGGTGG + Intronic
905509228 1:38505389-38505411 GTAGCTTATGTAATTTCAGGTGG - Intergenic
905530625 1:38675861-38675883 TTCACATACCTGAATTCAGGAGG + Intergenic
907024326 1:51100662-51100684 GTCCCATGTGCAAATTCAGGGGG - Intergenic
907784351 1:57597174-57597196 TTCTGATATGTAAATCCAGGTGG - Intronic
909568988 1:77086807-77086829 GTCACATATGTGTATTGTGGAGG - Intergenic
910785285 1:90990984-90991006 GACACATATATATACTCAGGAGG - Intronic
913360305 1:117973207-117973229 CTCACACATGTAAACTCAGATGG - Intronic
915062130 1:153194934-153194956 CTCACATGTGAACATTCAGGAGG + Intergenic
916869568 1:168898129-168898151 GTCACCTATGTAAGATCAGGAGG + Intergenic
920548803 1:206840871-206840893 GTCAGATGAGTAAACTCAGGTGG - Intronic
923880938 1:238103638-238103660 TTCACATCTGTAAATTCAGCAGG - Intergenic
924279746 1:242424456-242424478 TACACATATGAAATTTCAGGTGG - Intronic
1064308032 10:14186310-14186332 GTCGCATGTGCAAATTCAGGGGG - Intronic
1064367877 10:14724618-14724640 GTCACATTTTTATTTTCAGGAGG + Intronic
1065614049 10:27501955-27501977 GCCAGAGATGTAAATTCGGGAGG + Intergenic
1067514610 10:46927485-46927507 GTCACATATGTAAATTCAGGGGG - Intronic
1067647650 10:48124328-48124350 GTCACATATGTAAATTCAGGGGG + Intergenic
1068047840 10:51910231-51910253 GTCACATAGGTAAATCCAGTGGG + Intronic
1069061740 10:63901887-63901909 GTGACAGATGTAGATGCAGGGGG + Intergenic
1069257591 10:66353334-66353356 GGCACAATTGTAAATTCAGTAGG + Intronic
1071165164 10:82797825-82797847 GTCAAATATGCAACTTCAGGAGG - Intronic
1073133888 10:101208711-101208733 GTCGCATGTGCAAATTCAAGGGG - Intergenic
1073401763 10:103263286-103263308 GTCACAGAAGTAAATTCATAGGG + Intergenic
1075311076 10:121414018-121414040 GGCACATCTATACATTCAGGAGG + Intergenic
1079844994 11:25454261-25454283 TACATATATGTAAATTCAGAAGG + Intergenic
1083087307 11:60163107-60163129 TTCACCTATGTAAATTCTTGTGG - Intergenic
1085179455 11:74521231-74521253 GTAAGATATCTAAATTAAGGAGG + Intronic
1085873575 11:80379821-80379843 TTCACCTATGTAAATTCACCAGG - Intergenic
1087368018 11:97246714-97246736 GTCAGATATGAAGATACAGGAGG - Intergenic
1088930177 11:114343184-114343206 GTCACATGTGTGAATTTGGGGGG + Intergenic
1095358874 12:41311429-41311451 TTCACATCAGTAAGTTCAGGTGG + Intronic
1095432338 12:42147376-42147398 ATCAAATAGGTAAATTTAGGTGG + Intergenic
1096164781 12:49413231-49413253 GTCAGATATGTAAGTACAGAAGG - Intronic
1096928534 12:55176498-55176520 ATTGCATATGCAAATTCAGGGGG - Intergenic
1098314185 12:69176324-69176346 GTCCCATATGTAAATTTGGGAGG - Intergenic
1099350769 12:81565964-81565986 GTCACATATGTATATTTACAGGG + Intronic
1101832312 12:108268496-108268518 GTCATACATTTAAAATCAGGAGG + Intergenic
1105318513 13:19291918-19291940 GTCACCTATGAAATTTTAGGAGG - Intergenic
1106875380 13:34066442-34066464 GTCACATGTGCAAACTCAGGGGG - Intergenic
1107069639 13:36256199-36256221 GTCACTTAGGGAAGTTCAGGAGG + Intronic
1107688243 13:42925561-42925583 GTTACCTCTGGAAATTCAGGTGG - Intronic
1107976733 13:45695608-45695630 GTTGCATGTGCAAATTCAGGGGG + Intergenic
1108551680 13:51552194-51552216 ATCACATGTGCAAATTCAGGGGG - Intergenic
1110554702 13:76845732-76845754 GTCTCATATGGAAATTTTGGAGG + Intergenic
1110611731 13:77495561-77495583 TACACATGTGTAAATTCAGTAGG - Intergenic
1111281225 13:86028080-86028102 GGAACATCTGTAACTTCAGGAGG + Intergenic
1113304552 13:109063475-109063497 GTCACATATGAATTTACAGGAGG - Intronic
1113476283 13:110583779-110583801 GTCACATGTGAAAAAGCAGGAGG - Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1115145383 14:30220196-30220218 GTTAAATATGTAAATTCATAAGG + Intergenic
1115175000 14:30552292-30552314 GTCACAGGTGCAAATTTAGGGGG - Intergenic
1115349975 14:32383558-32383580 GTAACATATATAAATTCAACTGG + Intronic
1116906365 14:50407667-50407689 GACACATATGAAACATCAGGAGG - Intronic
1118513501 14:66502658-66502680 GTCACATATTAATATTCAGAAGG - Intergenic
1121510204 14:94506591-94506613 GTCACATATACAATTTCTGGAGG - Intronic
1123702879 15:22928660-22928682 GTCACATGTTTAAATTTAGGGGG - Intronic
1125376960 15:39040337-39040359 GACACATATGTAAATGCATGAGG + Intergenic
1126883589 15:53125465-53125487 GTTAGCTATGTAAATTAAGGAGG + Intergenic
1130932617 15:88440525-88440547 ATTGCAGATGTAAATTCAGGTGG + Intergenic
1131215472 15:90531635-90531657 GTCACAGATGTAAATGCCAGTGG - Intronic
1131377537 15:91937901-91937923 TTCACATCTGTAAATTTTGGAGG + Intronic
1132063754 15:98713685-98713707 GGCACTTAGGTAAATTCAGCAGG - Intronic
1134559598 16:15196843-15196865 CTCACACCTGTAATTTCAGGAGG - Intergenic
1134920137 16:18108454-18108476 CTCACACCTGTAATTTCAGGAGG - Intergenic
1135890948 16:26356687-26356709 GTCACATGTGAACATTCAGTTGG - Intergenic
1135927613 16:26709411-26709433 CTCACATATGCAAATTTGGGAGG + Intergenic
1138110522 16:54320232-54320254 GTCACATAATTATATTCTGGAGG - Intergenic
1142824756 17:2502261-2502283 GCCAGATATGCAAAGTCAGGAGG + Exonic
1144430295 17:15185172-15185194 GTCACATGTGCAAATTCAGGGGG - Intergenic
1144843529 17:18203621-18203643 GTCACAAATCTGGATTCAGGAGG - Intronic
1146523827 17:33548840-33548862 GTCCCATATGAAGCTTCAGGGGG - Intronic
1148208178 17:45792527-45792549 GTCATATATGTATATTCTGCTGG - Intronic
1150329546 17:64283905-64283927 TTCCCCTAAGTAAATTCAGGTGG + Intergenic
1151009114 17:70472993-70473015 GTGACATATGTGAATACTGGTGG - Intergenic
1153973925 18:10250054-10250076 GACAGATATGTGAAGTCAGGGGG - Intergenic
1157344481 18:46812703-46812725 GTCACATATTTAAATCCCAGTGG + Intronic
1158195555 18:54881391-54881413 GTCACGTGTGGAAATTCAAGGGG + Intronic
1159073059 18:63647634-63647656 GTCTCATATGTAAGTACAGTTGG + Intronic
1159109506 18:64040906-64040928 GCCATATATGTACTTTCAGGGGG - Intergenic
1159538218 18:69742034-69742056 GTCAAATATGTTTATTCATGTGG - Intronic
1159634269 18:70786252-70786274 GGCACATATGTCAATTGAGGAGG - Intergenic
1159856910 18:73599687-73599709 GTCCCATGTGCAAATTCAGGAGG - Intergenic
927340378 2:21977028-21977050 GTCTCATATGTAAGCTCTGGAGG - Intergenic
928237692 2:29558936-29558958 GTCAAATATGAAAATTTAAGAGG + Intronic
929748793 2:44688535-44688557 GTCATATATTTAATTTCAGATGG + Intronic
930919254 2:56731799-56731821 TTCATATATGTAAATTTATGGGG - Intergenic
932255769 2:70284786-70284808 GACAAATATGTAAATTTAGCAGG - Intronic
937146566 2:119650868-119650890 GTGACATATGTAAAAAGAGGTGG - Intronic
938593019 2:132757934-132757956 GTCACATGTGCAAATGCAGGGGG - Intronic
941016999 2:160368938-160368960 GTAACATATCTAAATTAATGGGG - Intronic
941967924 2:171318378-171318400 GTAAAATATGTGAAATCAGGAGG - Exonic
944505464 2:200406158-200406180 GTCACATAAGTAAATAATGGTGG + Intronic
945502626 2:210595770-210595792 TGCACATCTGTAAATTGAGGAGG + Intronic
946050739 2:216860184-216860206 GTCACATTTGTGAAATAAGGTGG + Intergenic
949038599 2:241833825-241833847 GACACATATGCATATTCAGCAGG + Intergenic
1169510671 20:6260715-6260737 GTCAGATCTGTATATTCTGGAGG + Intergenic
1170017822 20:11801886-11801908 GTCACATATGCATATTTAAGAGG - Intergenic
1170044346 20:12069873-12069895 GTAACATATGTATATGCATGTGG + Intergenic
1172383937 20:34519657-34519679 GTCCCATATGTACATTTAGGTGG + Intronic
1173534471 20:43798910-43798932 GAGACATAAGTAAACTCAGGGGG - Intergenic
1173562597 20:44016957-44016979 ATCAGAAATGTAAATTAAGGTGG + Intronic
1177456533 21:21346307-21346329 GACAAATGTGTAAATTCAGCAGG + Intronic
1177838285 21:26209773-26209795 ATTAAATATGTATATTCAGGTGG - Intergenic
1181308124 22:21928397-21928419 GTCACAAAAGTGAGTTCAGGAGG - Intronic
1184536854 22:45093466-45093488 GTCACATGTGCAAATTCAGGGGG + Intergenic
949379666 3:3430774-3430796 GTCATAATTGAAAATTCAGGAGG - Intergenic
949739424 3:7213557-7213579 GACACAGATGTATATACAGGAGG + Intronic
953054025 3:39373064-39373086 ATCACATGTGCAAATTCAAGGGG - Intergenic
953984223 3:47428989-47429011 GTCCCATGTGCAAATTCCGGGGG - Intronic
957573792 3:81983807-81983829 GTCATATATGGAAATTCAGTGGG + Intergenic
958665810 3:97137134-97137156 ATCACATTTATAAATTCAGTGGG + Intronic
959600729 3:108181813-108181835 GTAACAAATGTAAATACAGGTGG - Intronic
960505584 3:118489342-118489364 GTTGCATGTGCAAATTCAGGGGG + Intergenic
961110698 3:124280731-124280753 ATCTCATATATAAATACAGGAGG + Intronic
961540257 3:127594595-127594617 CTCTAATATGTAAATTCAGGTGG + Intronic
961776818 3:129292988-129293010 GTCTCATGTGCAAATTCAGGGGG + Intronic
963564591 3:146912633-146912655 GTCAGATATCCAAATTTAGGGGG - Intergenic
964579935 3:158222465-158222487 GTGAAATATGTAAATACTGGGGG - Intronic
966158758 3:176946345-176946367 AACACATGTGCAAATTCAGGGGG + Intergenic
967825289 3:193872621-193872643 GTAACATGTGTAAAGTCATGGGG - Intergenic
968171964 3:196517993-196518015 CTTACATATGTAAATGCTGGTGG + Intergenic
970447227 4:16134386-16134408 GTCACATAGGTAGAATCAGGAGG + Intergenic
972525193 4:39903193-39903215 GTCACATAGTTAAAAACAGGGGG + Intronic
973175487 4:47199958-47199980 ATCCCATATGTACATCCAGGTGG - Intronic
973184373 4:47307246-47307268 GTTAAATAGGTAAATTCTGGAGG - Intronic
974600152 4:64068860-64068882 GTCACATGTGTATATTTAGATGG + Intergenic
974803891 4:66855683-66855705 GACCCATTTGTAAATTCATGTGG + Intergenic
974924561 4:68281452-68281474 GTAAAATATGTAAATTGAAGGGG + Intergenic
975366456 4:73534971-73534993 GTTACAACTGTAAATTAAGGTGG + Intergenic
975601169 4:76101024-76101046 GACATTTATGTAAATTCTGGGGG + Intronic
977105726 4:92881344-92881366 GTTATATATGTAAAATCAAGAGG - Intronic
977517501 4:98039659-98039681 ATCACATATGTAATTTTAAGGGG - Intronic
977991239 4:103444987-103445009 GTCACAAGTGCAAATTCAGGGGG + Intergenic
977995276 4:103493145-103493167 GGCACATATGTAAAGCCAGGTGG + Intergenic
978800504 4:112751407-112751429 GGCAAATATGTAAATCCATGAGG + Intergenic
979125122 4:116961084-116961106 ATCAGATATGTGAATTCAGCTGG + Intergenic
979902295 4:126237033-126237055 GTAAAATATGCAAAATCAGGGGG - Intergenic
980649825 4:135697715-135697737 GAGACATAAGAAAATTCAGGAGG - Intergenic
981646454 4:147004132-147004154 GTCACTCCTGTAAATTCAGGTGG + Intergenic
983208706 4:164936826-164936848 GTGACTGATGTAAGTTCAGGGGG - Intergenic
983471711 4:168164558-168164580 GTCCCACATTTTAATTCAGGGGG + Intronic
987741846 5:21918813-21918835 GTCATATATCTAAATTCAGATGG + Intronic
987957608 5:24761599-24761621 GTCACACATCTAGATACAGGAGG - Intergenic
988785633 5:34563591-34563613 GTCACATAGGTAGGTTCTGGGGG - Intergenic
991018250 5:61954239-61954261 TTCTCATGTGTAAAATCAGGAGG - Intergenic
991307130 5:65189198-65189220 TTCACATACATAATTTCAGGGGG + Intronic
991517642 5:67456587-67456609 GTCACATGTGCAATTTCAGTGGG + Intergenic
994934719 5:106239367-106239389 GTCTCATCTGTTAATTCAGAGGG + Intergenic
995621367 5:114029779-114029801 GTCATAGATGTGAATTGAGGAGG - Intergenic
996062969 5:119052164-119052186 GTCCCATATGAAAATTCCAGAGG - Intronic
996209001 5:120781687-120781709 TTCACATATGTATATTGACGGGG - Intergenic
998496881 5:142598466-142598488 GTCACCTATGTAATTTAGGGTGG - Intronic
998718702 5:144916726-144916748 GTGACTTCTGTAAATTCTGGTGG + Intergenic
999802245 5:155048978-155049000 GTTAGAAATGTAAATTCATGGGG + Intergenic
1007216257 6:40241625-40241647 GTTACATAGGTAATTTCATGGGG - Intergenic
1007571807 6:42897329-42897351 GTCACACATGTACCTTCAGTTGG - Intergenic
1008604845 6:53130419-53130441 GGGACGTATGGAAATTCAGGAGG + Intronic
1010405801 6:75504393-75504415 GTCAGATATGTAAAGTAAAGAGG + Intergenic
1011854016 6:91666001-91666023 TTCACATATGTATTTTCAGCTGG + Intergenic
1014609581 6:123524292-123524314 GTTACCTGTGTAAAGTCAGGTGG + Intronic
1015265645 6:131289602-131289624 GTCCCGTGTGCAAATTCAGGGGG - Intergenic
1016619126 6:146087492-146087514 GTCACATGTGTAGATTCATGTGG + Intronic
1016828911 6:148414254-148414276 TTCCCATATGTATATTCATGTGG + Intronic
1019975323 7:4576646-4576668 GTCACATGTGCAGATTCAAGGGG + Intergenic
1020773445 7:12424409-12424431 CTTGCATATGTAAATGCAGGTGG - Intergenic
1021126079 7:16852291-16852313 GTTAAATATGGAAATACAGGTGG + Intergenic
1024047377 7:45593860-45593882 ATCACATATGTATGTTTAGGTGG + Intronic
1024308390 7:47947326-47947348 GTCACATCTGTAAACTCCAGAGG - Intronic
1026078234 7:67192966-67192988 TTTGCATATGCAAATTCAGGGGG + Intronic
1026199005 7:68197893-68197915 GTCACATTTGTAAAGTATGGAGG - Intergenic
1029990314 7:104957345-104957367 ACCACATATGTGGATTCAGGAGG + Intergenic
1031205752 7:118755338-118755360 GTCACATGTGCAAATTTACGGGG + Intergenic
1031217141 7:118909300-118909322 ATCACATATGTGAACTCAGTAGG - Intergenic
1031230230 7:119096208-119096230 GTTACATATGCAAATTTATGTGG + Intergenic
1031310194 7:120186901-120186923 GTTGCATGTGCAAATTCAGGGGG - Intergenic
1031698579 7:124893673-124893695 GTTGCATGTGCAAATTCAGGTGG - Intronic
1036271414 8:7307158-7307180 ATCACATAAATAAGTTCAGGAGG + Intergenic
1036349934 8:8003191-8003213 ATCACATAAATAAGTTCAGGAGG - Intergenic
1037159347 8:15749436-15749458 GCCACATATGAAAATAGAGGGGG - Intronic
1037348161 8:17922426-17922448 CCCTCATATGTAAAATCAGGAGG + Intergenic
1038536544 8:28357223-28357245 GTCCCATATTTAAATTTAAGAGG + Intronic
1042177844 8:66055006-66055028 GTCACATTTGTAAAGTAAAGTGG - Intronic
1042740138 8:72034241-72034263 GTCTTACCTGTAAATTCAGGAGG + Exonic
1044091669 8:88010198-88010220 TTCACATGGGTAAATTCAGATGG + Intergenic
1045452512 8:102342089-102342111 GTCAAATTTCTAAAGTCAGGTGG - Intronic
1046714795 8:117555893-117555915 GTTACATTTGTTAATTCAGTAGG + Intergenic
1046892669 8:119439963-119439985 GTCCCTTATGTAAAATCATGTGG + Intergenic
1050873312 9:10603364-10603386 ATCACAAATGTGAATGCAGGAGG - Intronic
1055200922 9:73660849-73660871 AACAAATATGTAAACTCAGGTGG - Intergenic
1055501308 9:76905358-76905380 TTCACATCTGTAAATTGGGGCGG - Intronic
1057250184 9:93494707-93494729 GTCACTTGGGGAAATTCAGGAGG + Intronic
1057455258 9:95202946-95202968 GTCACATATTACAATTCAGATGG + Intronic
1057763669 9:97897074-97897096 TTCATATATGTAAAATGAGGAGG - Intergenic
1060010652 9:120040448-120040470 CTCAGATAGGAAAATTCAGGTGG + Intergenic
1185995166 X:4938782-4938804 GTCACAGTTGTCAATACAGGAGG - Intergenic
1187499337 X:19826240-19826262 GTCACAAATGTAACTTCTAGAGG - Intronic
1188424140 X:30027133-30027155 GTCATACAGGTAAATTAAGGTGG + Intergenic
1194876272 X:99192341-99192363 GACTTATATGTTAATTCAGGTGG - Intergenic
1196397636 X:115282593-115282615 GTCAGATATTTAAATTGGGGAGG - Intergenic
1199568126 X:149238929-149238951 TTCACATATGGAAATACAGGTGG + Intergenic