ID: 1067649506

View in Genome Browser
Species Human (GRCh38)
Location 10:48142530-48142552
Sequence GAAGCATTCATCACCACGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067649505_1067649506 30 Left 1067649505 10:48142477-48142499 CCTTTTTTTAAAAAAGGAGACAC No data
Right 1067649506 10:48142530-48142552 GAAGCATTCATCACCACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067649506 Original CRISPR GAAGCATTCATCACCACGCC TGG Intergenic
No off target data available for this crispr