ID: 1067653754

View in Genome Browser
Species Human (GRCh38)
Location 10:48175529-48175551
Sequence GCTTCCCTTGGAGGACAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067653754_1067653758 -6 Left 1067653754 10:48175529-48175551 CCCACTTGTCCTCCAAGGGAAGC No data
Right 1067653758 10:48175546-48175568 GGAAGCAGTATGTTTTCCCATGG No data
1067653754_1067653759 -3 Left 1067653754 10:48175529-48175551 CCCACTTGTCCTCCAAGGGAAGC No data
Right 1067653759 10:48175549-48175571 AGCAGTATGTTTTCCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067653754 Original CRISPR GCTTCCCTTGGAGGACAAGT GGG (reversed) Intronic
No off target data available for this crispr