ID: 1067656166

View in Genome Browser
Species Human (GRCh38)
Location 10:48193243-48193265
Sequence CTGTAAAAGCAGAAAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 568}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067656166_1067656170 27 Left 1067656166 10:48193243-48193265 CCTTCTGCTTTCTGCTTTTACAG 0: 1
1: 0
2: 4
3: 58
4: 568
Right 1067656170 10:48193293-48193315 AAATGTGCCTCCAAATCTCCTGG No data
1067656166_1067656171 28 Left 1067656166 10:48193243-48193265 CCTTCTGCTTTCTGCTTTTACAG 0: 1
1: 0
2: 4
3: 58
4: 568
Right 1067656171 10:48193294-48193316 AATGTGCCTCCAAATCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067656166 Original CRISPR CTGTAAAAGCAGAAAGCAGA AGG (reversed) Intronic
900723761 1:4200579-4200601 CTGCAAAAGAAAAAAGCAGCTGG + Intergenic
903462290 1:23528400-23528422 TTGTAAAATGAGTAAGCAGAGGG + Intronic
905078569 1:35296473-35296495 ATATAAAAGCAGAAATCTGAGGG - Intronic
905981005 1:42227269-42227291 CTGGAAATGCAGAAAGGATAAGG + Intronic
906233070 1:44182160-44182182 TTTTAAAAGAAGAAAGCAGCCGG - Intergenic
906271908 1:44485980-44486002 CTGTAAAACCTGATAGGAGAGGG + Intronic
907407449 1:54262406-54262428 CTGTCAGGGCAGAAAGCAAAGGG + Intronic
907417391 1:54323886-54323908 ATGTACAAGCAGAATGCAGCAGG + Intronic
907605177 1:55809202-55809224 CAGCAAAAGCAGTAATCAGAGGG + Intergenic
908017067 1:59853872-59853894 ATGTAACAGCATAAAGCAGAGGG - Intronic
908325605 1:63020523-63020545 GTGTAGAAGCAGAGAACAGAGGG + Intergenic
908347111 1:63245341-63245363 CTCGCAGAGCAGAAAGCAGAGGG + Intergenic
908520175 1:64934046-64934068 CACTAGAAGCACAAAGCAGAAGG + Intronic
908806867 1:67940734-67940756 CTGAGAGAGCAGAAAGCATAGGG - Intergenic
909162017 1:72164035-72164057 AAGTAAAAGCAGAAACAAGAAGG + Intronic
909337547 1:74493165-74493187 CTATAAAAACAAAAAGCAAATGG + Intronic
909523545 1:76597058-76597080 GTCTAAAAGCATAAACCAGAGGG + Intronic
909534972 1:76726363-76726385 AAGTGAAATCAGAAAGCAGATGG + Intergenic
910276175 1:85451343-85451365 ATATAAAGGCAGAAAGAAGAGGG + Intronic
910922219 1:92360430-92360452 TGGCAAAAGCAGAAAGGAGAGGG + Intronic
911254999 1:95622927-95622949 CAGTAAAGGCAGAAAGCAGTAGG - Intergenic
911305578 1:96228132-96228154 CTCTGAGAGCAGAATGCAGAAGG - Intergenic
911358547 1:96849481-96849503 CTGTAAAAGCAGTCAGGAGTGGG + Intergenic
911406478 1:97446641-97446663 CAGTTAAAGTAGGAAGCAGAAGG - Intronic
912191255 1:107343530-107343552 CTGTAAAAGCCAAAAGTAGAAGG - Intronic
912616311 1:111103060-111103082 CGGAAATAGCAGAAAGTAGAAGG - Intergenic
913263785 1:117024906-117024928 AAGTAAAAGCAGCAGGCAGAGGG + Intronic
914727598 1:150341207-150341229 CTATAAAAGGAGCAAGCTGAGGG - Intronic
914830574 1:151168102-151168124 CTGTAAAAGCAGTAAGGGAAAGG - Intronic
914898733 1:151699640-151699662 CTGTAAAAGCAAAAGGCTGTAGG - Intergenic
916244939 1:162677837-162677859 ATGTGAAAGCTGAAAGCTGAGGG - Intronic
916349034 1:163827885-163827907 CAGTATAAACAAAAAGCAGAGGG - Intergenic
917420396 1:174857126-174857148 CTGTAAAAGCAGACGACAGTGGG - Intronic
917449492 1:175135143-175135165 CTGTAAGAGCATAAAACAGGAGG - Intronic
917531473 1:175839871-175839893 CTGGAAAAGAGGAAACCAGAGGG + Intergenic
918779015 1:188671981-188672003 GTGTGAGAGAAGAAAGCAGAGGG + Intergenic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920212491 1:204338472-204338494 GTGAAAAAGGGGAAAGCAGATGG + Intronic
921329499 1:214021406-214021428 CTGTAAAATCAGAAAGGAAATGG - Intronic
921877682 1:220217421-220217443 ATGGAAAAACAGAAAGGAGAGGG - Intronic
922068286 1:222165905-222165927 CTGAAGAAGGAGAAAGCAGTAGG + Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922367915 1:224883248-224883270 CTTTAAAAGGATAAAACAGAGGG + Intergenic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
923766597 1:236897953-236897975 CTGTAAAAACAGAAAAAAGCAGG - Exonic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
923981470 1:239328677-239328699 CAGTAACAACAGAAAACAGAAGG - Intergenic
924582191 1:245332163-245332185 CAGGAAATGCAGTAAGCAGATGG + Intronic
1063153037 10:3354235-3354257 CTATAAAGACAAAAAGCAGAAGG - Intergenic
1063506952 10:6608190-6608212 GTTTTAAAGCAGAAAGCAGCAGG - Intergenic
1064372416 10:14764054-14764076 CTGGTATACCAGAAAGCAGATGG + Intronic
1064850706 10:19706081-19706103 CTGTAAAAGGAGATAGCATTTGG + Intronic
1064977270 10:21131253-21131275 CTTTGAAAACAGAAAGCACAAGG + Intronic
1065085977 10:22176954-22176976 CTGCAAAATCAGAAAGAATATGG + Intergenic
1065426316 10:25608006-25608028 CTGTAGAAGCAGAATGCAAGGGG - Intergenic
1065868172 10:29932242-29932264 CTGTAAATGCAGCATGCAGCTGG - Intergenic
1066231967 10:33443479-33443501 CAGTAAAAACAGAAAAGAGAGGG - Intergenic
1067012973 10:42731775-42731797 CAGAAACAGCAGACAGCAGAGGG - Intergenic
1067349005 10:45458867-45458889 CTATAAAAGCAGGAAGTAGCTGG - Intronic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1067915619 10:50394978-50395000 ATGTAAAAGCAAAAAGGAGTGGG - Intronic
1068148147 10:53097782-53097804 CTGTAAAAGCAGCTAGAATAGGG + Intergenic
1068477038 10:57540291-57540313 CTGGGAAAGCTGAAAACAGAAGG + Intergenic
1068776127 10:60870341-60870363 CTGTGAAAGCACAAAGCTGGAGG - Exonic
1068972456 10:62974234-62974256 CTGTAAAAGCAGCCAGGAGGGGG - Intergenic
1070342335 10:75509378-75509400 CTGTGGAAGCAGAAAGTAAAAGG - Intronic
1072466487 10:95667363-95667385 ATGCAAAAACAGAAAGCAGATGG + Intronic
1072486183 10:95858200-95858222 CTGTGAAAGCAGATAACAGAGGG + Intronic
1072554084 10:96501440-96501462 CTGTAGAAGCAGGAAGCAGGAGG - Intronic
1072660090 10:97358609-97358631 CTGGGCAAGCAGAAAGCAAAAGG - Exonic
1072740555 10:97906601-97906623 CTGAAAAATCATAAAGCAAAGGG - Intronic
1073371270 10:102991495-102991517 CTGTAATGGAGGAAAGCAGATGG - Intronic
1073540277 10:104312197-104312219 CTTCTAAAGCAGAAAGCAGTGGG - Exonic
1073817692 10:107225318-107225340 CAATCATAGCAGAAAGCAGAAGG + Intergenic
1074496757 10:113986419-113986441 CTGTAAGTGCAGAAAGCACATGG - Intergenic
1075634501 10:124021079-124021101 ATGTAAAAGCTGAAAACTGATGG - Intronic
1076388139 10:130074153-130074175 CAAAAAGAGCAGAAAGCAGAGGG + Intergenic
1076694079 10:132238601-132238623 CTGGGAAAGCATAGAGCAGACGG + Intronic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1079584022 11:22102889-22102911 TTGAAAAAGCAGAAAACAGTTGG + Intergenic
1079637294 11:22759677-22759699 CTGTTACTGCAGAAATCAGAAGG - Intronic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1080759905 11:35238393-35238415 AGGTAAAACCAGAAAGAAGAGGG + Intergenic
1081249644 11:40813982-40814004 CTGTGAAAGCAGCCAGGAGAAGG - Intronic
1081491256 11:43570810-43570832 CTATAAAAGTAGAAAGAAAAGGG - Intronic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081817492 11:45957626-45957648 CTGTGAAAGCAGTACTCAGAGGG + Intronic
1082640287 11:55651570-55651592 CTGAGAAAGCAGTCAGCAGAAGG + Exonic
1083028583 11:59571583-59571605 CTTTAAAGGCAAAAAGCTGAAGG - Intergenic
1083169740 11:60915968-60915990 CTGTAAGCCCAGAAGGCAGATGG + Intronic
1083725704 11:64626966-64626988 CTCTAAACGCAGAAACCAGTTGG - Intronic
1084290423 11:68162015-68162037 CTGCCAAAGCAGAAAGCTGGAGG + Intronic
1084345880 11:68548525-68548547 TGGTAAAAGCAGAAATGAGAGGG + Intronic
1085996346 11:81919399-81919421 CTGTCAAAGCAGGAAGCAAAAGG - Intergenic
1086022981 11:82254703-82254725 GTGTTAAAGCAGAATGGAGATGG + Intergenic
1086127127 11:83360430-83360452 ATGTGATAGCAGAAAGGAGAAGG - Intergenic
1087042254 11:93813018-93813040 TTGAAAAAGCAGAGAGCTGATGG - Exonic
1087056935 11:93945951-93945973 CTGTAATAGCCGGAATCAGAAGG - Intergenic
1087877523 11:103375488-103375510 CTGTGAAAGCAGCCAGGAGAGGG + Intronic
1087917766 11:103830743-103830765 ATGTCACAGCAGAAGGCAGAAGG - Intergenic
1088841740 11:113633256-113633278 CTGTCCAAGCAGAAAGCATGGGG - Intergenic
1089136317 11:116252170-116252192 TTCTAAAACCAGAAAGGAGAGGG - Intergenic
1089357521 11:117864149-117864171 CTGAAAAAGAACAAAGCTGAAGG + Intronic
1089406094 11:118198749-118198771 CTTTAAAAGCAGAAAATACAAGG - Intronic
1090930105 11:131289998-131290020 CTGTACAAGCAGTAAGAAAAAGG - Intergenic
1091046460 11:132330106-132330128 CTGTTAAGGTCGAAAGCAGACGG - Intronic
1091123634 11:133077562-133077584 CTTCAAAAGCAAAAAGCACAAGG + Intronic
1091166459 11:133480396-133480418 CAGAAAAAGCAGAAGGCAGTGGG - Intronic
1091539901 12:1450346-1450368 GAGTAAAATCAGAAGGCAGATGG - Intronic
1091907208 12:4198617-4198639 ATCTGAGAGCAGAAAGCAGAGGG + Intergenic
1091957333 12:4657725-4657747 CTATAATAGCAGAAAGCAATCGG - Intronic
1093007244 12:14064029-14064051 TTGTGAAAGAAGCAAGCAGAAGG - Intergenic
1093145993 12:15567519-15567541 AAGTAAAAGCAAGAAGCAGAGGG - Intronic
1093622742 12:21311923-21311945 CTCAAAAAGAAGAAAGAAGAAGG + Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094244378 12:28271431-28271453 CAGTTAAAGCAGTAATCAGAGGG - Intronic
1095260526 12:40093949-40093971 GTGTATAAAAAGAAAGCAGAGGG + Intronic
1095298685 12:40557056-40557078 CTTTGAAAGTAGAAAGTAGAAGG + Intronic
1095382865 12:41615872-41615894 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1095828249 12:46553457-46553479 CTATAGATGCAGAAAGAAGAAGG + Intergenic
1096586594 12:52626647-52626669 CTGTGAAAGGAGAAAGGATAAGG + Intergenic
1097296726 12:57973255-57973277 CTGTAAAAGAACAAAGCTGGAGG + Intergenic
1097322273 12:58239350-58239372 CTGGAAAAAAAGAGAGCAGAAGG - Intergenic
1097524711 12:60717210-60717232 CTATAAGAGCTGAAAGTAGAAGG - Intergenic
1098014040 12:66085598-66085620 TTTTAAAAGGAGAAAGCACAGGG - Intergenic
1098572498 12:72004714-72004736 TAGCAAAAGCAGAAAGAAGATGG + Intronic
1099160160 12:79231155-79231177 ATTTAGAAGCAGAAACCAGAGGG + Intronic
1099552750 12:84068824-84068846 CTGTAAAAGTAAAAACCAAAGGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100038903 12:90287739-90287761 CAATGAAAGCAGAAAGCAGTGGG - Intergenic
1100705920 12:97199985-97200007 CTGTACAGGCTGAAAGCTGAGGG - Intergenic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103889374 12:124227341-124227363 CTATAGAGACAGAAAGCAGATGG + Intronic
1104021987 12:124998564-124998586 CCGTAGAGACAGAAAGCAGATGG + Intronic
1104212390 12:126701846-126701868 CTGTACAAGCAGAAAACACAAGG + Intergenic
1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG + Intergenic
1105842470 13:24266672-24266694 CTGTAAAAGGATTAAGCACAGGG - Intronic
1106273391 13:28176973-28176995 CTGAAAAACCAGGAAGAAGAAGG + Intronic
1106864204 13:33945958-33945980 CAGTAAGATCAGAAAGCAAAAGG - Intronic
1107306533 13:39026388-39026410 CTGTAATATAAGAAAGAAGAGGG + Intronic
1107568422 13:41630425-41630447 GTGTTCAAGCAGAAAGAAGAAGG - Intronic
1107635473 13:42388125-42388147 CTGTGTCAGCAGAAAGCAAAGGG + Intergenic
1108046253 13:46387234-46387256 CGGTAACAGCAGAAAGGGGAGGG + Exonic
1108190025 13:47928860-47928882 CTGCATATGCAGAAAGCACATGG + Intergenic
1108362936 13:49684063-49684085 CTTTAAAGACAGAAGGCAGACGG + Intronic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108909721 13:55531217-55531239 TTGTAAAGGCAAAAAGCAGGAGG + Intergenic
1109697397 13:65978162-65978184 CTGTGAAAGCAGTCAGGAGAGGG + Intergenic
1109848602 13:68031430-68031452 TAGTAAAAGCAGAGACCAGATGG + Intergenic
1110038469 13:70718480-70718502 CTGTGAAAGCAGCAAGGAGGGGG + Intergenic
1110667877 13:78138937-78138959 CTGTAAAAGCAGACAGTACTTGG - Intergenic
1110970417 13:81754295-81754317 CTGTAAAAGCAGCAAGAATGGGG + Intergenic
1111799032 13:92959917-92959939 TTGTAAAAGCAGCCAGCAGGGGG - Intergenic
1112753785 13:102608208-102608230 CTGTTAAAGTAGAAAACAGTAGG - Intronic
1113029339 13:105976435-105976457 CTGTGAAAGCAGCCAGGAGAGGG - Intergenic
1113137318 13:107106949-107106971 CAGTAAAAGCAGTATTCAGAGGG - Intergenic
1113827240 13:113265839-113265861 CTGTAAAAGTGGAAAGGAGAAGG + Intronic
1114786619 14:25607404-25607426 CTTTGAAGGCAGAAAGCAGAAGG + Intergenic
1114917733 14:27288753-27288775 CTGTAAAAGCAGCCAGGAGGGGG - Intergenic
1115324349 14:32121772-32121794 CTGTAAAGGCAGAAAGTTGATGG - Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1116386462 14:44336683-44336705 TTTTAAAAGCAGAAAGCACAGGG + Intergenic
1116636471 14:47402601-47402623 ATGTAAAAGAAGAAAAGAGAAGG + Intronic
1116747867 14:48844945-48844967 CTAGAAAAGCAGGCAGCAGAAGG + Intergenic
1117059992 14:51952402-51952424 CTGAAAAAGCACAAAGCAACAGG + Intronic
1117409629 14:55439421-55439443 CTGTCAAAGCAGAAACCCGTGGG + Intronic
1118598066 14:67451419-67451441 CTGTGAAAGCAGCCAGGAGAAGG + Intronic
1119161345 14:72454966-72454988 TTGCAGAAGCAGAAAACAGAGGG - Intronic
1120005260 14:79349357-79349379 CTGTGTAAGCAGAAAGCAGGAGG + Intronic
1120030617 14:79636753-79636775 CTGCAAAGGGAGAAAGGAGAAGG + Intronic
1120375885 14:83706697-83706719 CTGTTGATGCAGAAAGCAGCAGG + Intergenic
1121641736 14:95489190-95489212 CAGTAAAAGCAGAAGACAAATGG + Intergenic
1121782619 14:96631681-96631703 ATGTAAAAGCAGAAAGGTGATGG - Intergenic
1121891391 14:97594598-97594620 CTGTAAAAGCACAAATAAAAAGG - Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1123877664 15:24639928-24639950 CTGGAAATGCAGAAATCAGTTGG + Intergenic
1124522342 15:30414876-30414898 CTGTAAAAGCACAAAGCTTTTGG + Intergenic
1124536322 15:30551342-30551364 CTGTAAAAGCACAAAGCTTTTGG - Intergenic
1124586183 15:31010423-31010445 CAGTAAAAGCAGTATTCAGAAGG - Intronic
1124716232 15:32065015-32065037 CCATAAAATCAGAAAGAAGAAGG + Intronic
1124762329 15:32456250-32456272 CTGTAAAAGCACAAAGCTTTTGG + Intergenic
1124776302 15:32592820-32592842 CTGTAAAAGCACAAAGCTTTTGG - Intergenic
1126418831 15:48449733-48449755 CTGTCACAGAAGAAAGCAAATGG + Intronic
1126436292 15:48641841-48641863 CTGTAACGGCAATAAGCAGAGGG + Intronic
1126582829 15:50257091-50257113 CGGTAAAAGGGGAAAGGAGAAGG - Intronic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1126949351 15:53863145-53863167 CTGCAAATGGAGAAACCAGAAGG + Intergenic
1127135525 15:55918787-55918809 CTGTAAAATCATAAAGGAGGTGG - Intronic
1127225259 15:56920106-56920128 CTGCTTAAGCAGAAAGCAGATGG - Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129375907 15:75131458-75131480 CTGTAAAACCAGAAGTGAGATGG + Intergenic
1129877598 15:78986293-78986315 CTGAAACAGCAGGAAGCAGTGGG + Intronic
1130333685 15:82940945-82940967 CTGTAAAAGAGGAAAACATATGG - Intronic
1130366439 15:83243972-83243994 CTGAGAGAGCAGAAAGCTGAGGG + Intergenic
1130420399 15:83740284-83740306 CTCAAAAAGCAGAAATCATATGG + Intronic
1130421983 15:83757016-83757038 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131619906 15:94057138-94057160 CTGTAAAAGCAAAAATCAGATGG + Intergenic
1131755470 15:95556077-95556099 CTCTAAGAGCAGAAAGAAAAGGG - Intergenic
1131823756 15:96299349-96299371 CTTTTAAAACATAAAGCAGAAGG + Intergenic
1131930046 15:97431768-97431790 CTGTGAAAGAAGAAATCATAAGG - Intergenic
1132128238 15:99249465-99249487 CTGATAAAGCAGGAACCAGAGGG - Exonic
1133047377 16:3096310-3096332 CAGGAAGGGCAGAAAGCAGAGGG - Intronic
1133174072 16:4000587-4000609 CAGTAAGAACAGACAGCAGATGG + Intronic
1134555689 16:15162068-15162090 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134916271 16:18073779-18073801 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1135352463 16:21740582-21740604 GAGTAAAAGCAGAGAGCAGGAGG - Intronic
1135450951 16:22556704-22556726 GAGTAAAAGCAGAGAGCAGGAGG - Intergenic
1135805363 16:25537672-25537694 CTGTAAAAGCAACGAGCAGTTGG - Intergenic
1135808526 16:25566422-25566444 CCGTAAAAGGAGAAAAAAGAAGG + Intergenic
1136642426 16:31578075-31578097 CTGTGAAAGCAGCAAGGAGTGGG + Intergenic
1136857187 16:33668082-33668104 CTCTAAAACCACAAGGCAGAGGG + Intergenic
1137880685 16:52044375-52044397 CTGTAAAAGGAGACAAAAGAAGG - Intronic
1138188140 16:54992533-54992555 CAGAAAAACCAGGAAGCAGAGGG - Intergenic
1138577814 16:57919719-57919741 CTCTAAAAACAGAGACCAGATGG + Intronic
1139744717 16:69065087-69065109 CTGAAATAGCACAAAGCAGCAGG - Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1140480253 16:75258555-75258577 CTTGCAAAGCAGACAGCAGAGGG + Intronic
1141191585 16:81828913-81828935 CTGTAAAATCAGAATGCAGTTGG - Intronic
1141274549 16:82574817-82574839 CAGCAGAAGCAGAAATCAGAGGG - Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1203118759 16_KI270728v1_random:1516573-1516595 CTCTAAAACCACAAGGCAGAGGG + Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1143179574 17:4975803-4975825 TTGAGAAAGCAGAAAGCAGCAGG + Intronic
1143567433 17:7732714-7732736 TGGAAAAAGCAGAAAGGAGAAGG - Intronic
1145889172 17:28402946-28402968 CTTTATAAGAGGAAAGCAGACGG + Exonic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146833951 17:36094866-36094888 CTGCCAAAGGAGATAGCAGAGGG - Intergenic
1148259108 17:46163909-46163931 CAGTATAGGCAGAAAGCACAGGG - Intronic
1148464799 17:47858301-47858323 CTTGGAAAGCAGAAAGCAGTTGG - Intergenic
1148570735 17:48666785-48666807 AAGTAAAACCAGAAAGCAGGAGG - Intergenic
1148616568 17:49004807-49004829 CTGTCAAAACAAAAAGCAGAAGG + Intronic
1149072253 17:52556787-52556809 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1149116097 17:53098006-53098028 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1150079333 17:62222774-62222796 CTGAAACTGCAGAAAGCATACGG + Intergenic
1151194027 17:72419312-72419334 CTGAAAAGGCACTAAGCAGATGG + Intergenic
1151264641 17:72945395-72945417 CTGTAAATGGAGCAAGGAGATGG - Intronic
1152437098 17:80283167-80283189 ATGGAAAAGCAGACAGCAGGAGG + Intronic
1153496022 18:5700441-5700463 CTGAAGAAGCTGAAAGGAGATGG + Intergenic
1153737492 18:8086350-8086372 CTCTAAAAGCAAAAAGCTGGAGG - Intronic
1155445688 18:25910921-25910943 CAATAATAGCACAAAGCAGATGG - Intergenic
1156013842 18:32525744-32525766 CTGTAACAGGAGAAAGGAGATGG - Intergenic
1156647117 18:39178156-39178178 CTGTAAAACCAGCAAGAATAGGG + Intergenic
1157074472 18:44449996-44450018 CTGTGGGAACAGAAAGCAGAAGG - Intergenic
1157817831 18:50743047-50743069 ATTTAAAAGCAAAAAGCAGAGGG - Intergenic
1157995229 18:52546817-52546839 CTGTAAACCTATAAAGCAGATGG + Intronic
1158177865 18:54677835-54677857 CTCTAAATCCAGAAAGTAGATGG - Intergenic
1159369204 18:67509892-67509914 CTGCAAAAGTTGAAAGCAAATGG - Exonic
1159517804 18:69480643-69480665 TTCAAAAAGCAGAACGCAGAGGG - Intronic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1159531767 18:69664490-69664512 CCATAAAAGAAGAAAGCACAAGG - Intronic
1161019283 19:2000421-2000443 GTTCAAAAGCAGAAAGCAGGAGG + Intronic
1161338158 19:3725758-3725780 CCTGAAAAGCAAAAAGCAGAAGG - Intronic
1162387963 19:10371688-10371710 CTGAAAAAGCACATTGCAGAGGG - Intronic
1163112606 19:15170552-15170574 CCCTAAGAGCAGGAAGCAGAGGG + Exonic
1164871279 19:31646134-31646156 ATGTAGAAACAGAGAGCAGAAGG - Intergenic
1165025021 19:32954294-32954316 CTCTAAAAACAGAAACTAGAAGG - Intronic
1165367827 19:35380198-35380220 CTGGAAAAGCTGTAAGCAGAAGG - Intergenic
1166023880 19:40060918-40060940 TTTTAAAAGCTGAAAACAGACGG + Intergenic
1168395155 19:56041152-56041174 CTCTCAAAGCAGAAGGCAGTGGG + Intronic
1168503343 19:56912199-56912221 CTCTAGAAGCAGAAAGAAGGAGG - Intergenic
925237732 2:2293800-2293822 TTGAAAATGCACAAAGCAGAAGG + Intronic
925508531 2:4597759-4597781 TTGTAAGAGCAGAAAGCTAAAGG - Intergenic
925724506 2:6859917-6859939 CTGTGAAAGCAGCAAGGAGGGGG + Intronic
926111662 2:10187823-10187845 CTGCAGAAGCAGGAAGCGGATGG - Intronic
926508707 2:13746221-13746243 CTGAAAAATCCAAAAGCAGAAGG + Intergenic
926659452 2:15447509-15447531 CGGTAAAAGGAGAGAGCACAAGG + Intronic
927001828 2:18803560-18803582 CTGTAAAATAAGATAGAAGAAGG - Intergenic
927091374 2:19715257-19715279 CTGTAAGAGTTTAAAGCAGATGG + Intergenic
927278038 2:21278488-21278510 ATAGAAAGGCAGAAAGCAGAAGG - Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
928096573 2:28408643-28408665 CTGGAAATGGAGAAAGGAGAAGG - Intronic
928456893 2:31430467-31430489 GGGGAAAAGCAGCAAGCAGAGGG - Intergenic
929259064 2:39844640-39844662 CTCTAGAAGCAGAAAACACAAGG - Intergenic
929445444 2:41997398-41997420 CTGGAAAAGGTGAGAGCAGAGGG + Intergenic
930164755 2:48194197-48194219 GTGTAAAATAAGAAAACAGAGGG + Intergenic
930187120 2:48421211-48421233 GTGTCAAAGCAGAAAGTATATGG - Intergenic
931093606 2:58914829-58914851 CTGTAAAGACAGAAAGCTTAGGG + Intergenic
931789610 2:65652791-65652813 CTGTGAAAGCTGTAAGCATAGGG - Intergenic
932435478 2:71700608-71700630 CTGAGAATGGAGAAAGCAGAGGG - Intergenic
932993603 2:76819853-76819875 CTGAAAAAGCAAAAAGTAGGTGG - Intronic
933203791 2:79481799-79481821 CTTTAAAAGAAGAAGACAGACGG + Intronic
933381672 2:81555285-81555307 ATATAAAAACAGAAAGCACAAGG + Intergenic
933390758 2:81663673-81663695 CTGTGAAAGCAGAAACAAGGGGG + Intergenic
933771260 2:85745777-85745799 CTGTAAACGGAGAAAAGAGAGGG - Intergenic
934601945 2:95664336-95664358 CTATAAAAGCAGAAGTCGGATGG + Intergenic
937560859 2:123222616-123222638 CAGCAAAAGCAGTAATCAGAGGG + Intergenic
937571311 2:123365691-123365713 CAGTAGCAGCAGAAAGCAGCAGG + Intergenic
937995127 2:127688218-127688240 CAGTAACAGCACAAAGGAGATGG - Intergenic
938172950 2:129098592-129098614 CTGAAAAAGCAGGAAGTAAATGG - Intergenic
939044464 2:137233836-137233858 CTGGTAAAGAAGAAAACAGAAGG + Intronic
939113743 2:138037690-138037712 CTGTGGAAGCAGTAAGGAGAAGG + Intergenic
939325694 2:140685139-140685161 CTGTGAATGAAGAAAGTAGAGGG - Intronic
939443040 2:142274725-142274747 TTGATCAAGCAGAAAGCAGAAGG - Intergenic
940137668 2:150457454-150457476 TCGTAAAAGCAGAAAGGACAAGG + Intergenic
941006016 2:160247840-160247862 CTATAAAGGCAGAAAACAGAAGG - Intronic
941382765 2:164816150-164816172 CTGTGAAAGCTTCAAGCAGAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941922115 2:170861829-170861851 CTCTACAAGCATAAAGCAGCAGG - Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942293662 2:174497522-174497544 TGGTAAAAGAAGATAGCAGATGG + Intergenic
944164410 2:196702900-196702922 ATGTCATGGCAGAAAGCAGATGG + Intronic
944236168 2:197443227-197443249 ATATAAAAGGAGAAATCAGAGGG + Intergenic
944492703 2:200274141-200274163 GTGACAAAGCACAAAGCAGAGGG + Intergenic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
945398316 2:209348798-209348820 ATGTCAAAGCAGACAGCAGGAGG - Intergenic
946428027 2:219609686-219609708 TTGTAAATGCAGCAGGCAGACGG - Intronic
946623265 2:221581676-221581698 CTCTATAATCAGAATGCAGATGG - Intergenic
946932653 2:224686239-224686261 AAGTAAAAGAAGAATGCAGAAGG - Intergenic
947190877 2:227503394-227503416 CTTTAAAAACAGAAAACTGAAGG - Intronic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948121743 2:235535953-235535975 CTGGGAGAGCAGGAAGCAGATGG - Intronic
948719210 2:239887209-239887231 GTGTAAAAGAAGAAATCAAAAGG + Intergenic
1169852307 20:10065470-10065492 CTGGAAAGGCAGAAAGAAAAGGG + Intergenic
1170093607 20:12620476-12620498 CAGTAAAAGCAGAAATCCAAAGG - Intergenic
1170273773 20:14559597-14559619 TTATAAAAACAGAAAGTAGAGGG - Intronic
1170778341 20:19400763-19400785 CTCTCAAAGCAGTAAGCAGAGGG + Intronic
1171129510 20:22637784-22637806 CAGTAATAGCATAAAGGAGAGGG - Intergenic
1171438867 20:25145554-25145576 CTGTGAAAACAGACAGCAGTGGG - Intergenic
1172452378 20:35035672-35035694 CTGTAACAGCAAAAAGGTGAAGG + Intronic
1172865108 20:38089903-38089925 TTGTACCAGCAGAAAGAAGAGGG + Exonic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173456831 20:43209563-43209585 ATGGAAAAATAGAAAGCAGATGG + Intergenic
1174903685 20:54527410-54527432 CTGTGAAAGCAGCGAGCTGAGGG - Intronic
1175016080 20:55792049-55792071 GAATAAAAGCAGAAAGCATAAGG + Intergenic
1176940056 21:14912588-14912610 CTGTTATAGCAGAAAGCAAAAGG - Intergenic
1179048391 21:37867688-37867710 CTGTAGAACCACACAGCAGATGG + Intronic
1181789653 22:25254973-25254995 CTGTGAAAGAAGAAAGCCCATGG - Intergenic
1181824471 22:25503808-25503830 CTGTGAAAGAAGAAAGCCCATGG - Intergenic
1182000139 22:26913417-26913439 TTGTAAAATGGGAAAGCAGAAGG + Intergenic
1182473026 22:30560367-30560389 CTGTAAAATGAGAAAGCTGGAGG + Intronic
1182568591 22:31218715-31218737 GGGACAAAGCAGAAAGCAGAAGG - Intronic
1182613899 22:31572800-31572822 ATCAACAAGCAGAAAGCAGATGG - Intronic
1183932318 22:41242644-41242666 CAAAAAAAGCACAAAGCAGATGG - Intergenic
1185183669 22:49379487-49379509 CTGTTAATGCAGGCAGCAGAGGG - Intergenic
949130834 3:498678-498700 CTATGAAAGCATAAAACAGAGGG + Intergenic
949446023 3:4134581-4134603 ATTCAAAAGCAGAAGGCAGAAGG + Intronic
949464355 3:4329114-4329136 CTGTTAAAGCAGCCAGGAGAAGG - Intronic
949852735 3:8435116-8435138 CTGTGAAAGAAGAAAGGAAAGGG + Intergenic
949944105 3:9176703-9176725 CTGTAAAAGCAGAAGCAAGTGGG + Intronic
951061396 3:18211052-18211074 ATATAAAAACAGAAAGTAGATGG + Intronic
952037804 3:29224155-29224177 CCCTAGAAGCAGAAAGCAAAGGG - Intergenic
952427982 3:33194676-33194698 CTGATAAGGCAGAAACCAGAAGG + Intronic
952456160 3:33474067-33474089 CTCTAGAAGCAGAAAACAGCTGG - Intergenic
952888632 3:38026914-38026936 TTGTAAAAACAGAAAATAGAGGG - Intronic
953482977 3:43268242-43268264 CTGGAAAAGGAGAAAGCCTAGGG - Intergenic
953853325 3:46482463-46482485 CTGTCAAAAAAGAAAGGAGAAGG + Intronic
953873753 3:46651500-46651522 CTTCAAAAACAGAAAGCAGTAGG + Intergenic
954389797 3:50262739-50262761 CAGTAAGGTCAGAAAGCAGAAGG - Intergenic
954516987 3:51187114-51187136 CTGTGAAAGCAGCCAGGAGAGGG + Intronic
954578047 3:51687618-51687640 CTGCCAAAGCAGAAAGCTGACGG - Intronic
955824900 3:62935342-62935364 CTGGACAAGCAGAATTCAGAGGG - Intergenic
956026472 3:64987955-64987977 CTGTAACAGCAGTGAGCAGGAGG - Intergenic
956600239 3:71013285-71013307 TTATAAATGTAGAAAGCAGATGG - Intronic
956983050 3:74662637-74662659 CTGTAAAAGCAGAATCTAGGTGG - Intergenic
957237639 3:77615041-77615063 CCATAAAAGTAGAAAGCAGGAGG - Intronic
957615973 3:82528016-82528038 CTGTAAAGGAAGTAAGGAGAAGG - Intergenic
957735402 3:84196335-84196357 CTGTAACAGCATATTGCAGAGGG + Intergenic
957942598 3:87023597-87023619 GTCTAAAAGCAGAGGGCAGAGGG - Intergenic
958057210 3:88428009-88428031 CTGTAAAAGCAGCCAGAAGGGGG + Intergenic
958441885 3:94165175-94165197 CTACCAGAGCAGAAAGCAGATGG + Intergenic
958665047 3:97126845-97126867 CAGTAAGAGCATAAAGAAGATGG + Intronic
959191405 3:103116314-103116336 CAGTAAAAGCAGTAATAAGAAGG + Intergenic
959701641 3:109304385-109304407 ATTTAACAGTAGAAAGCAGAGGG - Intronic
960078657 3:113516506-113516528 TTGTAACAGCAGAAAGCAAGGGG - Intergenic
960212037 3:114981173-114981195 CTGTAAAATTAGAAAGCAAGGGG - Intronic
960401203 3:117201253-117201275 CTGTTATTGCAGAGAGCAGAAGG + Intergenic
960529859 3:118751797-118751819 CTTTAAAAGATGAAAGCAGAAGG + Intergenic
960919297 3:122730318-122730340 CTGTAATAGAAGAAGCCAGAAGG - Exonic
960962477 3:123082105-123082127 CTGGACTTGCAGAAAGCAGAGGG + Intronic
961145988 3:124593689-124593711 CTGTGAAAGCAAATAGCAAATGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961671746 3:128537273-128537295 ACGTCAAAGCAGGAAGCAGAGGG + Intergenic
962254842 3:133863425-133863447 CTGTAAATCCAGAAAGGAGGAGG + Intronic
962445482 3:135459841-135459863 CCGTGAAAGCAGAAAACAGGAGG + Intergenic
962679720 3:137785614-137785636 CTGCAAAAGAAGAAAGCTAATGG - Intergenic
963242053 3:143015413-143015435 CTGAAAAACCAGAAATCATAGGG - Intronic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964633959 3:158841205-158841227 CTGAGAAAGCAGAAAGCAGATGG + Intergenic
965380457 3:167981751-167981773 CTGTAAAAACAAGAAGAAGAAGG - Intergenic
965888840 3:173484607-173484629 CTCTAAAAGGAGAATGAAGATGG + Intronic
965976641 3:174632456-174632478 CTATAAAAGCAAAAAATAGAAGG + Intronic
966019033 3:175183994-175184016 GTGTGAAGGCAGAAAGCTGAAGG - Intronic
966030733 3:175344388-175344410 GTGTAAATGTAGAAACCAGAAGG - Intronic
966212223 3:177465131-177465153 GGGTAAACGTAGAAAGCAGAAGG - Intergenic
966236101 3:177703499-177703521 GTGGAAAAGAAGAAAGGAGAAGG + Intergenic
966244325 3:177789799-177789821 CTATAAAAGCAGAGAGGAGAGGG + Intergenic
966408368 3:179622836-179622858 CTATAAAAACAGAAAGTAAAAGG + Intronic
966903664 3:184506332-184506354 CAGCAAAAGCTGAAACCAGAAGG - Intronic
968114709 3:196081018-196081040 CTCTACAAGCAGTAAGCAGAGGG + Intronic
969060546 4:4430777-4430799 CTGTAAGAGCACCCAGCAGAGGG - Intronic
969638510 4:8383049-8383071 ATGTAACAGCCGAAAGCAGTCGG - Intronic
969937317 4:10695428-10695450 TTATAAAATCAGAAAGCAGCTGG + Intergenic
970723969 4:19021020-19021042 CTGTAAAAGCAAAAGTGAGATGG - Intergenic
971597664 4:28552352-28552374 CTCAAATGGCAGAAAGCAGAAGG - Intergenic
972023380 4:34343445-34343467 TTGTAAAAGAATAAAGCATAAGG - Intergenic
972613170 4:40673837-40673859 CTGCTAAAGCAGAAAGCGGCAGG - Intergenic
973227348 4:47801673-47801695 CTGTCACAGCAGAAAGCAGAGGG + Intronic
973783121 4:54308965-54308987 GTGAAAAAGTAGAAAGCCGATGG + Intergenic
974101535 4:57422675-57422697 CTGTAAAAGCAGCCAGGAGAGGG + Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
974779193 4:66529186-66529208 CTGTAAAAGCAGACAGGAGGAGG + Intergenic
974940269 4:68459856-68459878 CTGTTACAGAAGAAAGGAGATGG - Intronic
975040396 4:69739074-69739096 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
975216892 4:71766024-71766046 CATTTACAGCAGAAAGCAGATGG - Intronic
975724210 4:77276288-77276310 GTGTAAAAGGAGAGAGCAGGTGG + Intronic
975749356 4:77506976-77506998 TAGTCAAAGCAGAAAGCAGTAGG + Intergenic
975826535 4:78325765-78325787 CTGAAATAGCACAAAGTAGACGG + Intronic
976014543 4:80535705-80535727 CAGTTAAAGCACAAAGCAAATGG - Intronic
977074658 4:92438274-92438296 CTTTAAAAAAAGAAAGCAGAGGG + Intronic
977446887 4:97141921-97141943 CTGTAAATGCAGAAAGCACCTGG - Intergenic
977635261 4:99291099-99291121 CTGTCAAATCATAAAGAAGAGGG + Intergenic
977708158 4:100094249-100094271 CAGTAAAACCAGAAGGCTGAAGG - Intergenic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978151671 4:105443332-105443354 GTGAAGAAGCAGAAGGCAGAAGG + Intronic
978792334 4:112675814-112675836 CTGTAAAAGAAGGATGCAGATGG - Intergenic
978853492 4:113366581-113366603 CTGAAACAGGAGAATGCAGAGGG - Intronic
978955811 4:114611907-114611929 CTGTAAAATCAGAAACCATGAGG + Intronic
979307328 4:119162265-119162287 GTGTGAAAGGAGAAAGCAGGCGG + Intronic
980634927 4:135489719-135489741 CTGTATTTACAGAAAGCAGACGG - Intergenic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
982501060 4:156155589-156155611 CTGTAACAGCACAAAGCAGATGG + Intergenic
982868910 4:160550914-160550936 AAGTTAAAGGAGAAAGCAGATGG + Intergenic
983718537 4:170816467-170816489 CTGTAAAAGCAGCTAGGAGTGGG + Intergenic
983866184 4:172769662-172769684 ATGTAAAGACAGAAAGCAAATGG - Intronic
984393064 4:179163552-179163574 CAGAAAAAGCAGACATCAGAAGG - Intergenic
984604404 4:181767997-181768019 ATGTAAATGCAGAAGGCAAATGG + Intergenic
984957686 4:185061964-185061986 TTACAGAAGCAGAAAGCAGATGG + Intergenic
985155933 4:186987270-186987292 CTGTGAAAGCAGTCAGGAGAGGG - Intergenic
985431775 4:189888122-189888144 CTGTGAAAGCAGCCAGGAGAAGG - Intergenic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
986233806 5:5889101-5889123 CTTTAAAAGCAGAAGACAGGAGG - Intergenic
987129497 5:14847637-14847659 CTGCCAAAGCACAAAGCATATGG + Intronic
987224105 5:15821778-15821800 CTCTCAAAGGAGAAAGCAGCAGG + Intronic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
988180923 5:27792061-27792083 CCCTGAAAACAGAAAGCAGACGG + Intergenic
988787613 5:34579116-34579138 CTGCAAGAGGAGAAAGGAGAGGG + Intergenic
988871230 5:35392301-35392323 CTGAATAGGCAGTAAGCAGATGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989480740 5:41926990-41927012 CTGAAACAGAAGAAAGCAGCAGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990087971 5:52002503-52002525 CTGTGAAAGAATAAATCAGAGGG + Intergenic
991518938 5:67472604-67472626 CAGTAAAAGAAGAAAACAGATGG + Intergenic
992544621 5:77800009-77800031 CTTTCAAAACAGAAAGCACAAGG + Intronic
992559457 5:77936005-77936027 CTGTAAAAGAGGAGAGCAAATGG - Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993379849 5:87194018-87194040 CTGTTTAAGCAGCAAGCACAGGG - Intergenic
993925875 5:93865567-93865589 TTTTAAAAGCAAAAAGCATACGG + Intronic
994598289 5:101867736-101867758 ATGGAAAAACAGAAATCAGAGGG + Intergenic
995074554 5:107966821-107966843 CTGCAAAACAGGAAAGCAGATGG - Intronic
995828580 5:116329204-116329226 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
996030594 5:118700058-118700080 CCCTACAGGCAGAAAGCAGATGG - Intergenic
996175568 5:120351725-120351747 AAGTAAAATTAGAAAGCAGATGG + Intergenic
996336029 5:122385067-122385089 CTGGCAAAGCTGAAAGCCGAAGG - Intronic
996766488 5:127039565-127039587 CTGTAGAGACAGAAAACAGATGG + Intergenic
996837536 5:127810482-127810504 CTGTATACCCAGAAAGGAGAGGG + Intergenic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999613024 5:153391347-153391369 CTATAAAGGCAAAAAGCACATGG - Intergenic
999770911 5:154774810-154774832 CTGTAAAAGAAGTGACCAGACGG - Intronic
1000252826 5:159511409-159511431 CTTTCACAGCAGAAAGTAGAAGG - Intergenic
1000521720 5:162302880-162302902 CTTTAATGGCAGAAGGCAGAAGG + Intergenic
1000832069 5:166114980-166115002 ATATAAAAGCAGAATGCTGAGGG - Intergenic
1000876605 5:166646893-166646915 ATGTCATAGGAGAAAGCAGAAGG - Intergenic
1001111304 5:168898434-168898456 CTCTTAAAGCAGAAAGCATATGG + Intronic
1001276522 5:170355321-170355343 CTGGAGAAGGAGAAAGCAAAGGG + Intronic
1001397941 5:171429889-171429911 CTGGAAAAGTAGAAAGGAGGTGG + Intronic
1001622361 5:173098425-173098447 CTGTATAACTAGAAATCAGAAGG - Intronic
1002078216 5:176722313-176722335 CTGAAAAGTCAGGAAGCAGATGG - Intergenic
1003349355 6:5301448-5301470 CTCTAAAAGAACAAAGAAGATGG + Intronic
1003892270 6:10574129-10574151 CTGTAGAAGAAGAAAGGAAACGG + Intronic
1004124721 6:12862136-12862158 GTGTGAAAGGAGAGAGCAGATGG + Intronic
1004440965 6:15653472-15653494 ATTTAAAAGCAGCAAGTAGAGGG - Intronic
1005340488 6:24839273-24839295 CTGTAAAGGCAGAAGGCACCAGG + Intronic
1005351434 6:24939501-24939523 CACTTAAAGCAGAAAGGAGAAGG + Intronic
1006034974 6:31204235-31204257 CTGTAAAAGCAGCAGCCAAATGG - Intergenic
1006242466 6:32696678-32696700 CTGTCAAAGAACGAAGCAGATGG - Intergenic
1006989402 6:38200259-38200281 CTGCAAAAGCAGTACTCAGAGGG + Intronic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1007932442 6:45704472-45704494 ATCTAAATACAGAAAGCAGAGGG + Intergenic
1007992721 6:46274321-46274343 CTGTGGAAGCAGAAAACAAAAGG + Intronic
1008360287 6:50609468-50609490 CTGTAAAAGCTTAAAGGACAGGG - Intergenic
1009324765 6:62337309-62337331 CTTTAAAAGCAGAAACTAGATGG + Intergenic
1009647936 6:66432042-66432064 TTGTAACAGAAGAAAACAGAAGG + Intergenic
1009783775 6:68303979-68304001 CAGTGAAAGCAGTAAACAGAGGG + Intergenic
1010636426 6:78264220-78264242 ATATACAAGTAGAAAGCAGAAGG + Intergenic
1010712294 6:79189195-79189217 CTGTAAAGGCAGAAATCTGTTGG + Intergenic
1011505297 6:88035307-88035329 CTGTCAAAACAGAAAGCACCAGG - Intergenic
1011515575 6:88149013-88149035 CTGTCATAGAATAAAGCAGATGG + Intronic
1011844428 6:91545847-91545869 CAGTCATAGCAGAAATCAGATGG + Intergenic
1011995416 6:93580894-93580916 TTGTAAAAGAACAAAGCATATGG + Intergenic
1013151139 6:107447625-107447647 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1013335943 6:109161378-109161400 CTGCTGGAGCAGAAAGCAGAGGG + Intronic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013863911 6:114670970-114670992 CTTCAAAAACAGAAAGCAGCAGG - Intergenic
1015480651 6:133704338-133704360 CAGTAAAAGGAGAAAACTGAAGG - Intergenic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1017630263 6:156390011-156390033 ATGTAAAGGTAGAAAGTAGAAGG + Intergenic
1017979046 6:159382689-159382711 CTGGAAAACCAGAAAACAGATGG + Intergenic
1018802422 6:167234799-167234821 GTGTCACAGCAGGAAGCAGATGG + Intergenic
1018808365 6:167278697-167278719 GTGTCACAGCAGGAAGCAGATGG - Intronic
1020359422 7:7311527-7311549 TTATAAAGACAGAAAGCAGATGG - Intergenic
1020526981 7:9274676-9274698 CTAAAAAAGCACACAGCAGAGGG - Intergenic
1020705487 7:11538751-11538773 CTGTCAGAGAAGAAAACAGAGGG - Intronic
1021049408 7:15964256-15964278 CTGTCAAAGGAGAAAAGAGATGG + Intergenic
1021262121 7:18471345-18471367 GTGTAAAAGCAGAAAGGCTATGG - Intronic
1022605834 7:31813145-31813167 CTGTTAAAAGAAAAAGCAGAGGG + Intronic
1022838226 7:34136978-34137000 CAGAGAAAGCAGAGAGCAGAGGG + Intronic
1023652659 7:42388106-42388128 CTGTAAAAGCAGAGAGGTGGTGG + Intergenic
1025061309 7:55810941-55810963 CTGTACAAGGAAAAGGCAGAAGG - Intronic
1026886306 7:73949414-73949436 CAGGAGAAGAAGAAAGCAGAAGG - Intergenic
1027434168 7:78146816-78146838 CTATAAAAGGAAAAAGGAGATGG - Intronic
1027630466 7:80598003-80598025 AACTGAAAGCAGAAAGCAGAAGG - Intronic
1028084271 7:86617175-86617197 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1028941482 7:96526729-96526751 CTCTGAAAGGAGAAAGGAGAGGG - Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1030407974 7:109139141-109139163 CAGCAAAAGCAGTAACCAGAGGG - Intergenic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1030625791 7:111844742-111844764 CTGTAAGATCATAGAGCAGATGG - Exonic
1030722340 7:112884687-112884709 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1030952938 7:115814710-115814732 CTTTAAAAGTCAAAAGCAGAAGG + Intergenic
1031652871 7:124313198-124313220 CTCTAAAAGAAGAAAACACATGG - Intergenic
1031715532 7:125104390-125104412 GCGAAAAAGCAGAAAGCAGTGGG + Intergenic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1032986176 7:137339827-137339849 ATGTAAAAGCAGGAAGAAAAGGG + Intronic
1033049031 7:137987568-137987590 CTGTAATAGCAGGATGCTGATGG + Intronic
1033352593 7:140573738-140573760 CTGTGAAAGAAGACTGCAGAGGG - Intronic
1033885085 7:145934402-145934424 CTGTGAAAGCAGCCAGCAGGGGG + Intergenic
1034383397 7:150718653-150718675 CTCCAAAAGCAAAAAGCAGAGGG - Intronic
1034652987 7:152706938-152706960 CTGTAAAAGAAAAATGCAAAGGG - Intergenic
1034763814 7:153698235-153698257 CTGTACAAGCAGACAGCGTACGG - Intergenic
1036521363 8:9494493-9494515 CAGTAAGAGCAGAAAGTAGATGG - Intergenic
1036524250 8:9520367-9520389 TTTTAAGACCAGAAAGCAGAGGG - Intergenic
1037067857 8:14604982-14605004 ATGTAAAAGCAGACAGTAAATGG - Intronic
1037244781 8:16821260-16821282 TTGTAGAAACAGAATGCAGAAGG + Intergenic
1039232575 8:35464902-35464924 CTGTAAAGGCAGAACAGAGAAGG - Intronic
1039778812 8:40763303-40763325 CTGGAAAAGTAGAAAACAAAAGG - Intronic
1039935607 8:42041613-42041635 CTGTAATCGCAGACAGCAGGAGG + Intronic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1041310804 8:56514530-56514552 CTCTAAAAGTAGAAACCAGGGGG + Intergenic
1041777091 8:61535255-61535277 CTACAAAAGCAAACAGCAGATGG + Intronic
1041842459 8:62288097-62288119 CTGTAGAAGCACAAGGCAAATGG - Intronic
1042505308 8:69553175-69553197 GAGAAAAAGCAGAAAGCAGATGG + Intronic
1042635648 8:70870552-70870574 CTATATAAGCACAAAGCAGCTGG - Intergenic
1042838693 8:73101874-73101896 CTGTAAAAGCAGGAATCTGTGGG - Intronic
1042938622 8:74085575-74085597 TTGGAAAAGCAGAAAGGAGCTGG - Intergenic
1043507659 8:80918640-80918662 GTGTAAAAGCAGGAAATAGAAGG + Intergenic
1043554086 8:81409765-81409787 CTGTTATAGCAGAAAGCAAAAGG + Intergenic
1043822076 8:84879076-84879098 CTCTAAAAGCAAAAAACAAAAGG + Intronic
1043823539 8:84897819-84897841 CTGTGAAACCAGAAACCAGTAGG - Intronic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044052544 8:87525546-87525568 CTGTAAAATCAGTCATCAGATGG - Intronic
1044376044 8:91472300-91472322 CTGCAAAATCAGAAAGGAGATGG - Intergenic
1045099371 8:98829002-98829024 CTCTCAGAGCAGAGAGCAGATGG - Intronic
1045356808 8:101396653-101396675 CTGTAACAGCAGAAAGGACAGGG + Intergenic
1045423779 8:102042781-102042803 GGGTAAGGGCAGAAAGCAGAGGG + Intronic
1045894865 8:107202675-107202697 CTGTGAAAGCAGCCAGCAGTGGG - Intergenic
1047602634 8:126441538-126441560 CTACAAAAGAAGAAAGCATAGGG + Intergenic
1047795530 8:128251416-128251438 CTATTTAAGGAGAAAGCAGAAGG - Intergenic
1048116756 8:131532186-131532208 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1048256110 8:132906471-132906493 CTGTTAAAACTGAGAGCAGATGG + Intronic
1048349237 8:133602611-133602633 CAGTGATAGCAGAAAGAAGAGGG + Intergenic
1048572266 8:135665989-135666011 CTTCAAAAGCAGGAAGCAAAAGG + Intergenic
1048930532 8:139311888-139311910 CTGTCAAGACAGAAAGCACATGG + Intergenic
1049180391 8:141219150-141219172 CTGGAGAAGGAGAAAGCAGTAGG + Intronic
1049228650 8:141470668-141470690 CTGGAACAGCAGAGACCAGAAGG - Intergenic
1049985449 9:946693-946715 AAATAAAACCAGAAAGCAGAAGG + Intronic
1050066311 9:1763473-1763495 CAGCAAAAGCAGACTGCAGAAGG + Intergenic
1050099497 9:2103325-2103347 TTGTAAAAACAGACAGCAGACGG + Intronic
1050119756 9:2296101-2296123 CTTGAAAAGCAGGAAGAAGACGG + Intergenic
1050260507 9:3836515-3836537 CTGGAAAAGAAGAAATCTGAAGG - Intronic
1050582283 9:7072560-7072582 CTGTAAAAGCAAAACACACAAGG + Intronic
1051022432 9:12560004-12560026 CTGTAAAAAGAGAAAGTAGCAGG - Intergenic
1051063513 9:13073705-13073727 CTCTGAAAGCAGTAAGCTGAAGG - Intergenic
1051352405 9:16210128-16210150 TTGAAAAAGAAGAAAGCTGAAGG - Intronic
1051725500 9:20084516-20084538 CTGTGAAAGAAAAAAGGAGAGGG - Intergenic
1051874685 9:21778996-21779018 CTGTAGAAGCTGAGAGCAGAAGG - Intergenic
1052072854 9:24104608-24104630 CTGTAAAAGCTGAAATATGATGG - Intergenic
1053450679 9:38191883-38191905 CTGGAAAACCAGGAAGCAGGGGG + Intergenic
1054754566 9:68944710-68944732 CTGTAATGGCAGGAAGAAGAGGG - Intronic
1055595615 9:77862096-77862118 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1055795930 9:79975045-79975067 CTGGAAGTGCAGGAAGCAGAGGG + Intergenic
1055969961 9:81901948-81901970 TTGTAAAATGAGAAAGCAGACGG + Intergenic
1056325581 9:85475567-85475589 CTGTAAAAGCAGCCAGGAGGGGG + Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058681034 9:107440422-107440444 CTTTAAAAGAGGAAAGGAGAGGG + Intergenic
1058784724 9:108375762-108375784 CTGTAAAAGCAGTAACAATAAGG + Intergenic
1059872832 9:118596958-118596980 GTTTAAAAGGAGAGAGCAGAGGG - Intergenic
1060313223 9:122483630-122483652 CTAGAAAAGGAGAAAGCAAAGGG + Intergenic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1060721203 9:125980222-125980244 CTTCCAAAACAGAAAGCAGATGG - Intergenic
1060835353 9:126751563-126751585 CTGTGAAAGGAGAAAGGAGGAGG - Intergenic
1185766599 X:2730679-2730701 TTGTAAATGCACAAAGCAAAGGG + Intronic
1186392573 X:9175605-9175627 AAGTAAGATCAGAAAGCAGATGG - Intergenic
1187196067 X:17085313-17085335 CTGAAAAAGAATAAAGCAGGAGG - Intronic
1187426480 X:19181830-19181852 CTGAAAGAGCAGAAGGGAGATGG + Intergenic
1187767917 X:22663865-22663887 TTATAATAGCAGAAAGCAAAGGG + Intergenic
1188010815 X:25054122-25054144 GTATAAAAGCTGTAAGCAGAAGG - Intergenic
1188127158 X:26383518-26383540 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1188577915 X:31675212-31675234 GTGAAAAAACAGAATGCAGATGG - Intronic
1188606832 X:32041482-32041504 ATGTTAACTCAGAAAGCAGAAGG - Intronic
1188616561 X:32165254-32165276 CTGTAAAAGCAGCCAGGAGAGGG + Intronic
1188773906 X:34189415-34189437 CTGTAAAAGCAGCCAGGAGGGGG - Intergenic
1188817930 X:34738503-34738525 CTATCCAAGCAGAATGCAGAAGG + Intergenic
1189237828 X:39501859-39501881 CTGAAAAAGAAAAAGGCAGAAGG + Intergenic
1189795015 X:44637122-44637144 CTGTAGTGACAGAAAGCAGATGG - Intergenic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1190553187 X:51606285-51606307 CTGTAAAAACAGATGACAGAAGG - Intergenic
1190824457 X:54004293-54004315 CTATAAAAGAGAAAAGCAGATGG + Intronic
1191139934 X:57105972-57105994 CTGGAAAAACAGATAGCAAAGGG + Intergenic
1193201828 X:78700300-78700322 CTGGAAAATAAGAAAGCAAATGG - Intergenic
1193306018 X:79952964-79952986 CAGTAAAAGCAGTACTCAGAGGG + Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1195512965 X:105738881-105738903 CTGTGAGGGCAGAAAGCAGAGGG + Intronic
1195521231 X:105832153-105832175 ATGTAAAAGCATAAAGCAAGGGG + Intronic
1195758196 X:108220058-108220080 CTGTAGAAGCATAATGGAGAGGG - Intronic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1197068426 X:122263624-122263646 CTGAAAAAGCAGTACTCAGAGGG - Intergenic
1197827888 X:130610194-130610216 CTCACAAAGCAGAAGGCAGAAGG - Intergenic
1197928573 X:131672520-131672542 ATATAAAAGTAGAAAGGAGAGGG - Intergenic
1197998775 X:132410037-132410059 CTCAAAAAGCAGCAAGCAGGGGG + Intronic
1198441233 X:136665273-136665295 CTCTAATATCAAAAAGCAGATGG + Intergenic
1198695168 X:139328359-139328381 CAGCAAAAGCAGTAATCAGAGGG + Intergenic
1199053038 X:143259827-143259849 CTGGAAACTCAAAAAGCAGATGG + Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199216547 X:145265894-145265916 CTATAAAAGTATAAAGCAGGAGG - Intergenic
1199811335 X:151352812-151352834 CTGTGAATGGGGAAAGCAGAAGG + Intergenic
1201685999 Y:16703060-16703082 CTGAAAAAGCAGGCAGAAGAAGG - Intergenic