ID: 1067658980

View in Genome Browser
Species Human (GRCh38)
Location 10:48219437-48219459
Sequence GTGTATCAGTAGGAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067658980_1067658987 21 Left 1067658980 10:48219437-48219459 CCTCTCTGCTCCTACTGATACAC 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1067658987 10:48219481-48219503 AGATGTCATGTCACACTGCTGGG No data
1067658980_1067658986 20 Left 1067658980 10:48219437-48219459 CCTCTCTGCTCCTACTGATACAC 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1067658986 10:48219480-48219502 CAGATGTCATGTCACACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067658980 Original CRISPR GTGTATCAGTAGGAGCAGAG AGG (reversed) Intronic
904554329 1:31348441-31348463 GTTTAGCAGAAGGAGCTGAGTGG - Intronic
907985298 1:59524307-59524329 GTGCCTCAGTAGGAACAGACTGG + Intronic
909732715 1:78914756-78914778 GTGTTTGAGTAGGGGCAGAGTGG + Intronic
910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG + Intronic
911196141 1:94997266-94997288 GTCTGTCAGTAGCACCAGAGTGG + Intronic
911803439 1:102174630-102174652 GTGATGCAGTGGGAGCAGAGAGG - Intergenic
912823404 1:112885142-112885164 CTGTTTCAGTAGGAGCCCAGAGG + Intergenic
913369738 1:118084672-118084694 GTGTATCTCTAGGTGCAGAGCGG + Intronic
914878844 1:151532393-151532415 GTGTTTCAGTTGGAGAAGATCGG + Exonic
916376560 1:164160561-164160583 GTGTAACTGTTGGAGGAGAGGGG - Intergenic
917588459 1:176452464-176452486 GTGTAGCAGGAGAGGCAGAGAGG + Intergenic
918649660 1:186945539-186945561 TTGTATCAGTACGATCACAGTGG + Intronic
919685416 1:200479531-200479553 GTGTGTCAGTGTGTGCAGAGGGG - Intergenic
919750545 1:201034922-201034944 GTGTACCCGTAGGAGCAGGTGGG - Intergenic
919840110 1:201602795-201602817 GAGTGTGAGTAGGAGCTGAGGGG - Intergenic
1065838013 10:29676833-29676855 GTGTGCCAGTAGGAAAAGAGGGG - Intronic
1066362078 10:34740709-34740731 CTGAATCAGTAGGAAAAGAGGGG - Intronic
1067658980 10:48219437-48219459 GTGTATCAGTAGGAGCAGAGAGG - Intronic
1068856711 10:61805290-61805312 GTGTAGCTGTAGCAGCAGTGGGG - Intergenic
1070081461 10:73192237-73192259 GTGAAGCAGTAGGAGTGGAGAGG + Intronic
1071701047 10:87936653-87936675 GTGTATAAGAAGGAGGAAAGAGG - Intronic
1071918088 10:90318854-90318876 GTGTAGCAGTAGCAGGAAAGGGG + Intergenic
1073252824 10:102132519-102132541 GTTTCTGAGTAGTAGCAGAGAGG + Intergenic
1073306150 10:102504575-102504597 GGGTGTGTGTAGGAGCAGAGGGG + Intronic
1083411921 11:62499762-62499784 GTGCAGCAGTAGGAGGACAGAGG + Intronic
1084326979 11:68406173-68406195 GGGTATCAGTAACAGCAGTGCGG - Intronic
1085889268 11:80558422-80558444 GTTTATCAGTATGAGCAGAATGG + Intergenic
1086590827 11:88511629-88511651 GTGCATCCATAGTAGCAGAGGGG + Intronic
1087550370 11:99640243-99640265 GTGTATCGGTACCAGTAGAGAGG - Intronic
1088815746 11:113419644-113419666 TTCTACCAATAGGAGCAGAGAGG + Intronic
1089288457 11:117422674-117422696 GTGTGTCTGTAGGAGAAGGGTGG - Intergenic
1089632371 11:119791779-119791801 GAGTATCAGTAGGAGGGGAGGGG - Intergenic
1089930623 11:122307265-122307287 GTGTCACAGCAGGAGCAGAAAGG - Intergenic
1090868575 11:130723426-130723448 GTGGAACTGTAAGAGCAGAGAGG + Intergenic
1093389930 12:18606047-18606069 ATGTAGCAGTAGGAGTAGAGAGG - Intronic
1097264579 12:57737997-57738019 GTGGATCAGCACGAGCAGCGCGG - Exonic
1099852363 12:88117544-88117566 GTATATGAGTAATAGCAGAGTGG - Intronic
1100275381 12:93067221-93067243 CTGTATCACTAGGAGCATATAGG - Intergenic
1101445033 12:104731485-104731507 GGGGATCAGAAGGAGAAGAGGGG + Intronic
1106393848 13:29361233-29361255 GTGTAGCTGTAGTAGCAGAGAGG - Intronic
1109093127 13:58073324-58073346 CTGTAGCAGGAGGAACAGAGAGG - Intergenic
1110160790 13:72375918-72375940 GTGTTTGAGTAACAGCAGAGAGG + Intergenic
1112158773 13:96847165-96847187 GTGTAGAAGGAAGAGCAGAGAGG + Intergenic
1112634154 13:101196607-101196629 CTGTTTCAGTATGAGGAGAGGGG + Intronic
1116600426 14:46915450-46915472 GTGTATCAATAAGAACAGAGGGG + Intronic
1117608148 14:57453390-57453412 TTGTTTGTGTAGGAGCAGAGGGG - Intergenic
1120107973 14:80517905-80517927 CTGGATCAGGAGGAGCACAGTGG + Intronic
1121776298 14:96593190-96593212 GTGGAGCAGAAAGAGCAGAGGGG + Intergenic
1122785163 14:104160153-104160175 GTGTAGCAGTCAGGGCAGAGTGG + Intronic
1124994907 15:34713971-34713993 ATGTAGCAGATGGAGCAGAGGGG + Intergenic
1126035514 15:44541553-44541575 GTGAATGAGTAGGACGAGAGAGG - Intronic
1126098645 15:45106647-45106669 GTGGATCAGAAGGAACAGTGAGG + Intronic
1132433722 15:101780063-101780085 GTGTTCCAGCAGGAGCAGAGAGG - Intergenic
1137700176 16:50491858-50491880 GTGAATCAGTATGATCAGACTGG - Intergenic
1138696786 16:58821293-58821315 GTGATTCAGTAGCAGCTGAGTGG - Intergenic
1140652254 16:77100994-77101016 GTGTAGAATTGGGAGCAGAGTGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142711442 17:1725938-1725960 GTGTCTCAAGAGGAGCAGGGAGG + Exonic
1147403618 17:40195350-40195372 GTGCATCAGCAGTAGCAGGGAGG - Exonic
1148930028 17:51120613-51120635 GTGTATCAGGAGGAGCCCGGCGG - Exonic
1151246376 17:72798094-72798116 GTGTATCACTAGGAGAAGTAGGG + Intronic
1152028283 17:77825792-77825814 GTGTCTCGGGAGGAGCAGAGAGG - Intergenic
1152035340 17:77868795-77868817 GTGTGTGTGTAGGGGCAGAGTGG + Intergenic
1156526932 18:37776528-37776550 GTGTATCAATAGGTGCAGGTGGG - Intergenic
1157478545 18:48038271-48038293 GAGAATCTGCAGGAGCAGAGGGG - Intronic
1163883824 19:19949022-19949044 GTGTAGGAATAGGAGGAGAGCGG - Intergenic
1164631447 19:29764420-29764442 GTGTCTCAGTAGGGGCTCAGAGG - Intergenic
1165361138 19:35337738-35337760 GGGTGTCTGGAGGAGCAGAGGGG - Exonic
1165369320 19:35394000-35394022 GTGTATAAGTAGAAGGATAGTGG + Intergenic
1167556500 19:50199450-50199472 GGGTATCAGCTGCAGCAGAGAGG - Intronic
1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG + Exonic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
926908907 2:17830852-17830874 GTGGATAAGGAAGAGCAGAGCGG + Intergenic
927917266 2:26945225-26945247 GGGTAGCAGAAGGAGTAGAGAGG - Intronic
931762359 2:65430080-65430102 GAGTAGCAGTAGTAGCAGTGAGG - Intronic
932604644 2:73156977-73156999 GTGGATCAGTGGGGGCAGTGAGG - Intergenic
933250923 2:80027603-80027625 GTGAAGAAGTAGGAGCAGACTGG + Intronic
933336508 2:80966389-80966411 GTGTATCATTAGGGAGAGAGTGG - Intergenic
934780720 2:96968222-96968244 GGGAATGAGCAGGAGCAGAGGGG - Intronic
937534473 2:122868839-122868861 GTGCATCAGTAAGAGAAGATTGG - Intergenic
938899999 2:135791687-135791709 GAGAATCAGAAGGAGTAGAGGGG + Intronic
942895480 2:181048075-181048097 GTTTATCAGTAGAAGCTGAAAGG - Intronic
945566848 2:211411631-211411653 GTGTGTGAGTTGGAGAAGAGTGG + Intronic
945866860 2:215185710-215185732 GAGAATCAGTAGGATTAGAGTGG - Intergenic
946152020 2:217781771-217781793 GTGTAGAAGTAGGAGAAAAGTGG + Intergenic
946584438 2:221169282-221169304 ATGTATCATTAAGAGCAAAGTGG + Intergenic
947016490 2:225626300-225626322 GTGTAGCAGAAGCAGCACAGTGG + Intronic
948128173 2:235580253-235580275 GTATATCCTTAGGAGCTGAGTGG + Intronic
1170242449 20:14183179-14183201 GCCTATCAGAAGGAGGAGAGTGG - Intronic
1171266284 20:23774570-23774592 TTTTATCAGTAGGAGATGAGAGG + Intergenic
1173432638 20:43003724-43003746 GTGATTCAGTAGGTCCAGAGTGG - Intronic
1175508400 20:59503916-59503938 GTGGATGAGAAGGAGAAGAGGGG - Intergenic
1175969680 20:62678211-62678233 GTGCATAAGAAGGAGAAGAGAGG + Intronic
1177313942 21:19432111-19432133 GTGTATGAGTATTAGCAGTGGGG + Intergenic
1179294530 21:40049369-40049391 GAGTCACAGCAGGAGCAGAGGGG - Intronic
1179346235 21:40560164-40560186 GTGAAGATGTAGGAGCAGAGAGG + Intronic
1180693710 22:17738820-17738842 CTGTAGCGGTAGGAGCTGAGAGG - Intronic
1181313622 22:21958521-21958543 TTGTAGCAGTAGGGGCACAGCGG + Exonic
1181441825 22:22940511-22940533 ATGTGTCAGTGGCAGCAGAGTGG - Intergenic
1181548517 22:23620449-23620471 GTGTATAACTATGAGCAGAGGGG - Intronic
1181548926 22:23624737-23624759 GTGTATAATTATGAGCAGAGAGG - Intronic
950897144 3:16463277-16463299 GAGTCTCAGAAGGAGCAGAGAGG - Intronic
951646055 3:24892254-24892276 GTGTACCAGGTCGAGCAGAGAGG - Intergenic
956803495 3:72785650-72785672 GTGTATAGGTAGGACAAGAGTGG - Intronic
959745111 3:109767116-109767138 GTGCATGTGTGGGAGCAGAGGGG - Intergenic
960714434 3:120561108-120561130 ATGAGTCAATAGGAGCAGAGGGG + Intergenic
961819849 3:129570456-129570478 GGGGAGCAGGAGGAGCAGAGAGG - Intronic
964714373 3:159706335-159706357 GTGTGTCAAGAGGAACAGAGTGG + Intronic
964877745 3:161387904-161387926 GAGTAGAAGGAGGAGCAGAGTGG - Intergenic
965660622 3:171038225-171038247 GTGTACCAGTAAGATCACAGGGG - Intergenic
966016783 3:175149722-175149744 GTCTATCAGTAGCACCAAAGTGG + Intronic
967456265 3:189690007-189690029 GTGTGGCAGGAGGAGCAGAGAGG - Intronic
969721759 4:8896015-8896037 GGGTCTGAGTAGGAGCAGACAGG + Intergenic
970982513 4:22117247-22117269 GTGTAACTGTAATAGCAGAGGGG + Intergenic
971762983 4:30792705-30792727 CTATCTCAGTAGGAGCTGAGGGG + Intronic
972958968 4:44428759-44428781 GTGTATCAGAAGGCACAGAATGG + Intronic
975425963 4:74227840-74227862 GTGTAAAAGTAGAAACAGAGAGG + Intronic
978086030 4:104656603-104656625 GTGTTTCAGTAGAAGAAGTGTGG + Intergenic
982519053 4:156390172-156390194 GTGTATAAGGAAGAGCAGAAGGG + Intergenic
987038564 5:14040883-14040905 CCTTATCTGTAGGAGCAGAGTGG + Intergenic
987173902 5:15287150-15287172 GTGGATGAGTAGGACAAGAGGGG + Intergenic
990403614 5:55465781-55465803 GTGGAGGAGTAGGAACAGAGGGG - Intronic
990911097 5:60853099-60853121 GTGTATCTGTCTGAGCAGAAAGG - Intergenic
994145083 5:96385712-96385734 ATGGAGCAGAAGGAGCAGAGTGG + Intergenic
996522416 5:124441901-124441923 GTGCTTCTGGAGGAGCAGAGGGG - Intergenic
998821293 5:146060059-146060081 GTGCATCAGCAGGGGCAGTGAGG + Exonic
999216498 5:149940044-149940066 GTGAAGCAGTAGGAGTGGAGGGG + Intronic
1002391529 5:178916442-178916464 GTGTATCTGAAAGAGCAGAGAGG + Intronic
1003507475 6:6751654-6751676 GTGTTTCAGGAGGGGCAGATGGG + Intergenic
1004258132 6:14083872-14083894 GTGTGTCAGTGGAAGCAGAGTGG - Intergenic
1009762040 6:68020053-68020075 GTGTAACAGTTGAAACAGAGAGG - Intergenic
1011084013 6:83519018-83519040 GTGTATCTGTACCAGCATAGTGG - Intronic
1014142677 6:117962639-117962661 GTCTATCAGTAGGAGAGGAGTGG - Intronic
1014483532 6:121969761-121969783 ATGTATCATTAGGGGCAGAATGG + Intergenic
1015944570 6:138486850-138486872 GTGTATCATAAGCAGCAGAATGG + Intronic
1016580502 6:145624277-145624299 GTGTGACTGTAGAAGCAGAGGGG - Intronic
1020980053 7:15055588-15055610 GTGGAACAGTAGGTGCAAAGAGG + Intergenic
1023178225 7:37454343-37454365 GTGGAACAGCTGGAGCAGAGGGG - Intergenic
1025933716 7:66017004-66017026 GTGAAGCAGTGGGAGTAGAGAGG + Intergenic
1025950104 7:66138474-66138496 GTGAAGCAGTAGGAGTAGAGGGG - Intronic
1026216146 7:68350876-68350898 TTGGATCAGTAGAAGGAGAGAGG + Intergenic
1028947590 7:96598489-96598511 ATGTAAAAGTAGGATCAGAGAGG - Intronic
1032020474 7:128405031-128405053 GAGCATCAGAAGGGGCAGAGTGG - Intronic
1032446904 7:131992010-131992032 GTGGATGAGTAAGGGCAGAGGGG + Intergenic
1032483392 7:132264536-132264558 GTATAGCAGAAGTAGCAGAGGGG - Intronic
1032526481 7:132581717-132581739 GTGTGTGTGTAGGAGGAGAGGGG - Intronic
1034293596 7:149951137-149951159 GTGTTTCATGAGGAGCAGGGTGG + Intergenic
1034812470 7:154145716-154145738 GTGTTTCATGAGGAGCAGGGTGG - Intronic
1035035921 7:155893632-155893654 GTCTCTCAGTGGCAGCAGAGAGG - Intergenic
1035959200 8:4118144-4118166 GACTCTCAGTGGGAGCAGAGGGG + Intronic
1042455006 8:68990600-68990622 GTGTATGAGGGGGAACAGAGTGG - Intergenic
1043350574 8:79355603-79355625 ATGTGTCAGTGGCAGCAGAGTGG + Intergenic
1046239738 8:111475258-111475280 GTGTTTCAGTGAGAGTAGAGAGG - Intergenic
1047826054 8:128576809-128576831 GTGAATCAGGAGGAAGAGAGAGG + Intergenic
1047989683 8:130273130-130273152 GTGTATCAATAAGAACAGAGGGG + Intronic
1049787386 8:144457505-144457527 GTGTATCAGCATCTGCAGAGGGG - Intronic
1052695168 9:31869063-31869085 CTGTACCAGTAGCAGCAGATTGG + Intergenic
1053023557 9:34712395-34712417 GAGTCTCAGGAGGAGAAGAGAGG - Intergenic
1053279814 9:36812667-36812689 GTGGGTCAGCAGGAGCTGAGGGG - Intergenic
1054778062 9:69140463-69140485 GTGTGTCAGCAGGTGCAGCGTGG + Intronic
1054865853 9:70000253-70000275 CTGAATCAGTAGGACTAGAGTGG - Intergenic
1057330387 9:94108941-94108963 GTGTATTAGCATGAGCAGCGTGG + Exonic
1057991964 9:99779848-99779870 GTATATGAGTAGTAGCACAGAGG - Intergenic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1189643962 X:43106185-43106207 CTTTATCAGTAAGAGAAGAGTGG - Intergenic
1193591103 X:83389699-83389721 GTGTTTCAGTGAGAGTAGAGAGG - Intergenic
1196895843 X:120334727-120334749 CCTTATCAGTAGGAGCAGAATGG - Intergenic
1197641774 X:128975692-128975714 GTGTAGCAGAAGGAGAAGTGTGG - Intergenic
1197889757 X:131257588-131257610 GTGTGTTGGAAGGAGCAGAGAGG + Intergenic
1200842815 Y:7800845-7800867 GAGTCTCAGAAGGAGCAGAGTGG - Intergenic