ID: 1067664949

View in Genome Browser
Species Human (GRCh38)
Location 10:48269808-48269830
Sequence CTGTAGCACAGATGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067664943_1067664949 -10 Left 1067664943 10:48269795-48269817 CCCAGGAGACCTGCTGTAGCACA No data
Right 1067664949 10:48269808-48269830 CTGTAGCACAGATGGGAAATGGG No data
1067664941_1067664949 11 Left 1067664941 10:48269774-48269796 CCTTAACTCACACTTGACAGACC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1067664949 10:48269808-48269830 CTGTAGCACAGATGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067664949 Original CRISPR CTGTAGCACAGATGGGAAAT GGG Intronic
No off target data available for this crispr