ID: 1067665144

View in Genome Browser
Species Human (GRCh38)
Location 10:48271195-48271217
Sequence CAGAAGGACAGGAGGCAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1068
Summary {0: 1, 1: 1, 2: 9, 3: 95, 4: 962}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067665144_1067665155 5 Left 1067665144 10:48271195-48271217 CCCCCTTGCCTCCTGTCCTTCTG 0: 1
1: 1
2: 9
3: 95
4: 962
Right 1067665155 10:48271223-48271245 TCTGTGGGGACACTCGCATCTGG No data
1067665144_1067665153 -9 Left 1067665144 10:48271195-48271217 CCCCCTTGCCTCCTGTCCTTCTG 0: 1
1: 1
2: 9
3: 95
4: 962
Right 1067665153 10:48271209-48271231 GTCCTTCTGCAGGCTCTGTGGGG No data
1067665144_1067665152 -10 Left 1067665144 10:48271195-48271217 CCCCCTTGCCTCCTGTCCTTCTG 0: 1
1: 1
2: 9
3: 95
4: 962
Right 1067665152 10:48271208-48271230 TGTCCTTCTGCAGGCTCTGTGGG No data
1067665144_1067665156 26 Left 1067665144 10:48271195-48271217 CCCCCTTGCCTCCTGTCCTTCTG 0: 1
1: 1
2: 9
3: 95
4: 962
Right 1067665156 10:48271244-48271266 GGAGCTCCTTCTTCCCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067665144 Original CRISPR CAGAAGGACAGGAGGCAAGG GGG (reversed) Intronic
900295879 1:1949154-1949176 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
900421201 1:2556739-2556761 CAGACGGAGAGGAGGCTCGGGGG - Intronic
900638257 1:3676101-3676123 CAGAGGGACAGGAGACGGGGAGG + Intronic
900643763 1:3699478-3699500 GAGAAGGCCAGGAGGCCAGAGGG + Intronic
901167285 1:7229596-7229618 CAGGAGGAGGGGAGGCTAGGAGG + Intronic
901217869 1:7564947-7564969 GAGAAGCAAAGGAAGCAAGGTGG + Intronic
901410232 1:9077804-9077826 AGGAAGGACAGGAGGGAGGGAGG + Intronic
901610458 1:10494010-10494032 TGGGAGGACAGGAGGCAGGGAGG + Intronic
901658359 1:10783444-10783466 CAGAAGGAAAGGATGTGAGGGGG + Intronic
901685134 1:10939557-10939579 ATGAAGGTCAGGAGGTAAGGTGG - Intergenic
901834795 1:11917129-11917151 CACAATGGCAGGAGTCAAGGTGG + Intergenic
902107456 1:14049685-14049707 AAGAAGAACAGAAGGAAAGGAGG - Intergenic
902402385 1:16165376-16165398 AAGGAGGAAAGGAGGAAAGGAGG + Intergenic
902491000 1:16780479-16780501 CTAAAGGGCAGGAGGAAAGGAGG - Intronic
902833101 1:19030173-19030195 CAGAAGGGAAGGAGGGAGGGAGG + Intergenic
902912987 1:19614843-19614865 CAGGAGGACAGCAGGAGAGGAGG - Intronic
903262730 1:22140031-22140053 CAGAAGGGCAGGTGGCCTGGTGG - Intronic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
903552222 1:24165839-24165861 CTGAAGGTCAGGATACAAGGAGG - Intronic
903677638 1:25074447-25074469 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
903800546 1:25964011-25964033 CAGCAGGGGAGGAGGCCAGGAGG + Intronic
903941788 1:26936984-26937006 CAGAAGTACACGAGGCAATTTGG - Intronic
903996486 1:27308073-27308095 AAGCAGGACAGGGGGCAGGGAGG - Exonic
904442415 1:30540431-30540453 CAGCAGATCAGGAGGCAAGCTGG + Intergenic
904471195 1:30737483-30737505 AAGCAGGAGAGGAGGCATGGAGG + Intronic
904492624 1:30870277-30870299 CAGGAGGCCAGGAGGCCAGATGG - Intronic
904821915 1:33251069-33251091 GTGAAGGCCATGAGGCAAGGAGG + Intergenic
904876900 1:33662344-33662366 CTGAAGCACAGGGAGCAAGGAGG - Intronic
905121822 1:35688398-35688420 CAGCAGGACAGGGGTCAGGGAGG + Intergenic
905258361 1:36700275-36700297 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
905266302 1:36756445-36756467 GAGGAGGACAGGAGGAAAGAGGG + Intergenic
905273622 1:36802905-36802927 ATGAAGAAAAGGAGGCAAGGAGG - Intronic
905564013 1:38948881-38948903 AAGAAGGAAAGAAGGAAAGGAGG + Intergenic
905564016 1:38948889-38948911 AAGAAGGAAAGGAGGGAAGGAGG + Intergenic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
905865493 1:41374193-41374215 AGGAAGGCCAGGAGGGAAGGAGG + Intronic
906129888 1:43449785-43449807 TCCCAGGACAGGAGGCAAGGAGG + Intronic
906455470 1:45993257-45993279 CAGAAGCAAAGGATGCCAGGTGG - Intronic
907831793 1:58071141-58071163 CAGATGGGCAGGAGGAAACGAGG + Intronic
908185432 1:61648256-61648278 AAGAAGGAGATGTGGCAAGGTGG + Intergenic
909138855 1:71836924-71836946 AGGAAGGACAGGAGGGAGGGAGG + Intronic
910734907 1:90442955-90442977 CAGAAGGAAAGGAGGGAGGGAGG + Intergenic
910933362 1:92464737-92464759 CAGAAGGAGAGGAAATAAGGGGG + Intergenic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911450719 1:98056983-98057005 CAGCATGACAGGAGGCCATGTGG - Intergenic
911774560 1:101791774-101791796 CATAGGGACAGGAGGCATGTGGG + Intergenic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
913057345 1:115174791-115174813 CAGAATCTCAGGAGGCATGGAGG - Intergenic
913147487 1:116006654-116006676 GAGAAGGAAAGGAGGGAGGGAGG - Intronic
913454677 1:119019070-119019092 GTGCAGGACAGGAGGCATGGCGG - Intergenic
913535354 1:119767033-119767055 CACAAGGGAAGGAGGCAAGATGG - Intronic
913675223 1:121133959-121133981 AGGAAGGAAAGGAGGCAGGGAGG - Intergenic
913960931 1:143337722-143337744 CAGAGGCACAGGAGGCCATGGGG + Intergenic
914027059 1:143921579-143921601 AGGAAGGAAAGGAGGCAGGGAGG - Intergenic
914055284 1:144163294-144163316 CAGAGGCACAGGAGGCCATGGGG + Intergenic
914123861 1:144803067-144803089 CAGAGGCACAGGAGGCCATGGGG - Intergenic
914241512 1:145856229-145856251 CAGAAGAACAAGAGACAAGTAGG + Intronic
914767514 1:150651865-150651887 CAGAAGGAAAGGAGAGAAAGAGG + Intronic
915527006 1:156482116-156482138 GAGAAAGACAGGATGCAAGAAGG + Intronic
915578164 1:156795232-156795254 AAGGAGGAAAGGAGGAAAGGAGG - Intronic
915978461 1:160405778-160405800 AGGAAGGAGAGGAGGAAAGGTGG + Intronic
916185127 1:162124274-162124296 CAGAAGGGCAGAGGGCAAGACGG - Intronic
916270169 1:162932458-162932480 AAGAAGGACAGGAGGCAGAAAGG - Intergenic
916475593 1:165165780-165165802 AAGAAGGGAAGGAAGCAAGGAGG - Intergenic
916549541 1:165836950-165836972 CAGAAGGGCAGGAGGAGAGGAGG + Intronic
917070170 1:171141896-171141918 AAGAAGGAGAGGTGGGAAGGAGG - Intronic
917139077 1:171816564-171816586 AAGAAGGGAAGGAGGGAAGGAGG - Intergenic
917203700 1:172545872-172545894 CAGAAGGACGGAAGGCAGGCAGG - Intronic
917470559 1:175322778-175322800 AAGAAAGAAAGGAGGGAAGGAGG + Exonic
917536682 1:175879196-175879218 TTGAAGGACAGCAAGCAAGGTGG - Intergenic
918189894 1:182163967-182163989 CAGCAGGACAAGAGGTCAGGAGG + Intergenic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
919333026 1:196195314-196195336 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
919392978 1:197010589-197010611 AAGAAGGATGGGAGGGAAGGAGG + Intergenic
920226055 1:204440133-204440155 CAGAAGGACAATAAGCAAAGCGG + Intronic
920317721 1:205090863-205090885 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
920368989 1:205465477-205465499 CAGAAGGGCAGGCAGAAAGGAGG - Intergenic
920375442 1:205505507-205505529 CAGAGGGAAAGGAGGCTGGGTGG + Intronic
920462584 1:206152797-206152819 AGGAAGGAAAGGAGGCAGGGAGG - Intergenic
920573130 1:207032957-207032979 TGGAAGGACAGGTGGCAGGGAGG + Intronic
920634485 1:207686188-207686210 GAGAAGGAAAGGAGGGAAGGAGG - Intronic
920961201 1:210665551-210665573 CAGAGGGACAGCAGGCAGTGGGG + Intronic
921131984 1:212227793-212227815 TGGAAGGAAAGGAGGCAGGGAGG + Intergenic
923051636 1:230394569-230394591 CACAAGGAGAGGAGGGGAGGGGG - Intronic
923097750 1:230788958-230788980 AAGCAGGACATGAGTCAAGGAGG - Intronic
923332990 1:232942924-232942946 GAGAAGTACAGGAGAAAAGGAGG - Intergenic
923529444 1:234802055-234802077 CTAAAGGGCAGGAGGAAAGGAGG + Intergenic
923706537 1:236348809-236348831 GAGAAGGACTGGAGAAAAGGTGG - Intronic
923778395 1:236999780-236999802 CAGAGAGACAGGAAGCTAGGAGG + Intergenic
923867458 1:237955222-237955244 CAGAAAGGCAGGAGGAAAGTTGG - Intergenic
924116529 1:240753177-240753199 CAGAAGGGAGGGAGGGAAGGAGG - Intergenic
924543391 1:245002447-245002469 CAGAATGAGAGTACGCAAGGTGG - Intronic
924570669 1:245234942-245234964 CACAGGGGCAGGAGGCCAGGAGG - Intronic
1062935098 10:1379661-1379683 CAGAAGTAGAGGAGGGGAGGAGG + Intronic
1063073937 10:2695534-2695556 CAGGATGGCAGCAGGCAAGGGGG + Intergenic
1063087565 10:2833275-2833297 CAGGAGGACAGGAGAGAAGCAGG - Intergenic
1063121798 10:3109806-3109828 CAGAAGGACAGAGTGCAGGGAGG + Intronic
1063289957 10:4735092-4735114 AATAAGGCAAGGAGGCAAGGAGG - Intergenic
1063316312 10:5009760-5009782 CAGCAGGTGAGGAGACAAGGAGG + Intronic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1064283410 10:13971008-13971030 GTGTGGGACAGGAGGCAAGGCGG - Intronic
1064307142 10:14177548-14177570 CAGAGGGCCAGGAGGCAGCGGGG - Intronic
1064448558 10:15420164-15420186 CAGCAGCTCAGGATGCAAGGTGG - Intergenic
1064585556 10:16836567-16836589 CAGAGGGGCAGGAGGAAGGGAGG + Intronic
1064717141 10:18188259-18188281 AAGAAGGAAAGGAGGCAAGAAGG - Intronic
1064717144 10:18188275-18188297 AGGAAGGAAAGGAGGCAAGAAGG - Intronic
1064841438 10:19596809-19596831 AAGGAGGAAAGGAGGAAAGGAGG + Intronic
1065117306 10:22495320-22495342 CAGAAGGAGAGCAGGCAGAGGGG + Intergenic
1065366677 10:24944067-24944089 CAGAGGTAGAGGAGGAAAGGGGG - Intronic
1065890397 10:30116466-30116488 CAGCAGGACAAGCGGCCAGGAGG + Intergenic
1065930618 10:30475705-30475727 GAGAAAGAAAGGAGGGAAGGAGG + Intergenic
1066118540 10:32261813-32261835 CAGAAGTACAGGTGGCAACCTGG - Intergenic
1066214403 10:33272509-33272531 GAGGAGGAGGGGAGGCAAGGAGG + Intronic
1066285860 10:33965554-33965576 CAGGAGGCCAAGGGGCAAGGAGG - Intergenic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1067721726 10:48732412-48732434 GAGAATGAAAGGAGGGAAGGTGG - Intronic
1067811673 10:49432427-49432449 CTGAAGGAAAGGAGGAGAGGAGG + Intergenic
1067911067 10:50347508-50347530 CAGAAGGTCAGGAAGAAAAGGGG + Intronic
1068001249 10:51336698-51336720 CTTGAGGACAGGAGGCAAGGTGG + Intronic
1068080239 10:52310504-52310526 AAGAAGGAAAGAAGGGAAGGAGG + Intergenic
1068393967 10:56437124-56437146 CAGAAGGACAGAAGGGTAGGAGG + Intergenic
1069062333 10:63907003-63907025 CAGCAGTGGAGGAGGCAAGGAGG + Intergenic
1069258245 10:66361330-66361352 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
1070224047 10:74482272-74482294 CAGAAGGAAGTGAGACAAGGGGG + Intronic
1070363950 10:75717583-75717605 CTGTGGGCCAGGAGGCAAGGAGG + Intronic
1070654094 10:78259205-78259227 CAGAAGGACAAAAGGCAAAAGGG - Intergenic
1071127704 10:82354286-82354308 CAGAACTACAGGAGCCAAGGTGG - Intronic
1072190383 10:93073019-93073041 CAGCTGGACAGCAGGGAAGGGGG - Intergenic
1072426426 10:95334460-95334482 CAGGAGGGCAGGAGGAAGGGAGG + Intronic
1074279524 10:112037748-112037770 AAGAAGGAAAGGAGGAAGGGAGG + Intergenic
1074281557 10:112056467-112056489 CAGAAGAACAAGATGAAAGGAGG + Intergenic
1074453092 10:113575377-113575399 CAGAAGAATTGGCGGCAAGGAGG - Intronic
1074514192 10:114149659-114149681 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
1074580837 10:114717909-114717931 CAAAAGGAGAGGAGAGAAGGGGG + Intergenic
1074731824 10:116386493-116386515 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1074753312 10:116607427-116607449 CAGAAAGACAGTGGCCAAGGAGG + Intronic
1074963126 10:118465611-118465633 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1075105571 10:119538115-119538137 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1075215587 10:120530071-120530093 GAGAAGGACAGGATACAAGAAGG - Intronic
1075361050 10:121834392-121834414 CAGAAGGCAAGCAGGCATGGGGG + Intronic
1075502574 10:122989205-122989227 CAGAAGGGAAGGTGGTAAGGAGG + Intronic
1075513898 10:123094370-123094392 GAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1075742658 10:124705292-124705314 TAGAGGGGCAGGAGGGAAGGCGG + Intronic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076040852 10:127247330-127247352 AAGAAGGACAGGAGGAATGTGGG - Intronic
1076058977 10:127398481-127398503 CAGCAGCACAGGAGCCAGGGAGG - Intronic
1076527285 10:131120034-131120056 CAGAAGGGAAGAAGGCAGGGAGG - Intronic
1077367639 11:2167527-2167549 GAGAAGGGCAGGAGGGAGGGAGG + Intronic
1077636063 11:3841618-3841640 CAGCAGAACAGGGGGCGAGGGGG - Intergenic
1077930200 11:6723011-6723033 CAGAAGCACAAGAGGCAAAAGGG - Intergenic
1078641904 11:13104658-13104680 GAGAAGGAAAGCAGGCAATGAGG - Intergenic
1078867149 11:15308375-15308397 CAGATGGTCAGGAGACAATGTGG + Intergenic
1078867165 11:15308544-15308566 CAGAGGGAAAGGAGAAAAGGTGG - Intergenic
1079241678 11:18726360-18726382 CTGAAGGCCAGGCGGGAAGGAGG + Intergenic
1079540693 11:21570651-21570673 CAGAATGAGAGGTGGCCAGGGGG + Intronic
1079603773 11:22341796-22341818 CCGAAGGGCAGGAGCCAGGGCGG - Intronic
1079964391 11:26963189-26963211 AGGAAGGAAAGGAGGAAAGGAGG + Intergenic
1080279247 11:30537653-30537675 AAGAAGGAAGGGAGGAAAGGAGG + Intronic
1080471647 11:32551746-32551768 AAGAAGGATGGGAGGCAATGTGG + Intergenic
1080555962 11:33417751-33417773 CAGAAGGACAGAAGGAAGGAAGG - Intergenic
1080749310 11:35138363-35138385 CAGAAGGACATAAGGAAAGATGG + Intergenic
1080866220 11:36197696-36197718 CATAAGGACAGGAACCATGGTGG - Intronic
1081458311 11:43247114-43247136 AAGAAGGGAAGGAGGCATGGTGG + Intergenic
1082783042 11:57301736-57301758 AAGAAAGACAGCATGCAAGGTGG + Intronic
1082837800 11:57664275-57664297 CAGAAGGAGGGAAGGAAAGGGGG - Intergenic
1082849849 11:57754834-57754856 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1082930496 11:58598958-58598980 CAGCTGAACAGGAGGGAAGGGGG - Intronic
1083560730 11:63671224-63671246 CAGAACTACAGCAGGGAAGGCGG + Intronic
1083581969 11:63830761-63830783 CAGAAGTACAGGTGACAAGCTGG - Intergenic
1083780278 11:64914039-64914061 CTGAAGGGCAGGAGACAGGGCGG + Intronic
1084006181 11:66324865-66324887 CAGAAGAAAAGGAGAAAAGGAGG - Intergenic
1084115871 11:67042730-67042752 CAGGAGGTCAGGAGGCCAGGTGG + Intronic
1084290425 11:68162039-68162061 CAGGAGAGCAGGAGTCAAGGAGG - Intronic
1084424475 11:69077010-69077032 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424552 11:69077259-69077281 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424584 11:69077367-69077389 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084596513 11:70119915-70119937 AAGAAGAAAAGGAGGGAAGGAGG + Intronic
1084743252 11:71152505-71152527 CAGCAGGAAGGGCGGCAAGGAGG + Intronic
1085152305 11:74262034-74262056 CAGATGAACAGGAGACATGGTGG + Intronic
1085519620 11:77130450-77130472 CAGAGGGAGAGAAGCCAAGGAGG + Intronic
1085525104 11:77159545-77159567 CAGAGGGACAGAAGTCATGGAGG - Intronic
1085740465 11:79074350-79074372 CAGAAGGACAGAAGGAATGCTGG + Intronic
1086036279 11:82418546-82418568 AAGAAAGAAAGGAGGAAAGGAGG + Intergenic
1086052505 11:82610121-82610143 CAGAAGGAAAGGAGGGAAAGAGG + Intergenic
1086250746 11:84811203-84811225 AAGAAGTACAGGAGGTGAGGTGG - Intronic
1086307162 11:85493789-85493811 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
1086546425 11:87972969-87972991 CAGAAGGAAGAGAGGAAAGGGGG - Intergenic
1086971964 11:93091172-93091194 GAGAAGGAGAAAAGGCAAGGGGG - Intergenic
1088453434 11:110007540-110007562 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1088884156 11:113994154-113994176 CAGAGGCAAAGGAGGGAAGGTGG - Intergenic
1089313851 11:117577408-117577430 AGGAAGGAAAGGAGGAAAGGAGG - Intronic
1089489778 11:118875250-118875272 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1089594979 11:119572905-119572927 GAGATGGCCAGAAGGCAAGGAGG - Intergenic
1090471582 11:126985598-126985620 CAGAGGGACAGGAGGCACGAGGG + Intronic
1090531028 11:127591808-127591830 AAGAAGGAAGGGCGGCAAGGCGG + Intergenic
1090611868 11:128478420-128478442 AAGAAGGAAAGGAGGTAGGGAGG + Intronic
1090761947 11:129845590-129845612 CAGCAGGAAATGAGGCACGGAGG + Intronic
1091025554 11:132137811-132137833 CAGAACAACAGGAGGCCAGAGGG + Intronic
1091231275 11:133989364-133989386 CAGAACCGCAGCAGGCAAGGGGG - Intergenic
1091543910 12:1487742-1487764 GAGAAGGGTAGGAGGCAAGGAGG + Intronic
1092745569 12:11669334-11669356 CAGGAGGACGGGAGGAAAGGAGG - Intronic
1093152022 12:15633034-15633056 AGGCAGGACAGGAGGGAAGGAGG + Intronic
1093619017 12:21265004-21265026 CAGGAGGACATGAGGAGAGGAGG + Exonic
1093949857 12:25152674-25152696 CAGAAGTACAGGTGACAAGCTGG + Intronic
1093989371 12:25572807-25572829 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1094013158 12:25830274-25830296 CAGAAGGAAGGGAGGAAATGTGG - Intergenic
1094330386 12:29285552-29285574 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1094704802 12:32904269-32904291 CAGAAGGAAGGAAGGAAAGGCGG - Intergenic
1094765697 12:33592151-33592173 CAGAAGGATAGAGAGCAAGGTGG + Intergenic
1095089394 12:38089517-38089539 GAGAAGGAGAGGAGAAAAGGAGG - Intergenic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1096263976 12:50109640-50109662 CTGGAGGACAGGAGGCTATGGGG + Exonic
1096943188 12:55372461-55372483 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1097385281 12:58943700-58943722 TACAAGGACAGGAAGCAAGGAGG - Intergenic
1097430502 12:59499448-59499470 CAAAAGGCCAGCAGGCTAGGGGG + Intergenic
1097608436 12:61785106-61785128 GGGAAGGGCAGGAGGGAAGGAGG - Intronic
1097705831 12:62867399-62867421 CAGAAGGAAAGTAGGTAAGAGGG - Intronic
1098067304 12:66632274-66632296 CAGAAGGTCACAAGGCAAGTAGG + Intronic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1098333414 12:69377408-69377430 AAGAAAGAAAGGAGGGAAGGAGG - Intronic
1099072854 12:78067959-78067981 AAGAAGAAAAGGAGGAAAGGAGG + Intronic
1099208585 12:79757184-79757206 GAGAAAGACAGGAGTCAGGGTGG - Intergenic
1099430248 12:82574871-82574893 CAGTATGGTAGGAGGCAAGGAGG + Intergenic
1099669272 12:85669577-85669599 TGGAAGGATAGGAGGGAAGGAGG - Intergenic
1099890488 12:88583549-88583571 CAGGTGGACAGGAGGGATGGGGG + Intergenic
1100835731 12:98565237-98565259 AAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1101036133 12:100708484-100708506 CAGAAGGAAAGAAAGTAAGGAGG - Intergenic
1101334711 12:103786231-103786253 GATAAGGAGAGGAAGCAAGGAGG + Intronic
1101420669 12:104548246-104548268 AAGCAGGGAAGGAGGCAAGGAGG + Intronic
1102573065 12:113839276-113839298 CAGGAGGGCAGGAGGCCAGCAGG + Intronic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1102699779 12:114829120-114829142 GAGAAAGAAGGGAGGCAAGGTGG - Intergenic
1102900057 12:116629412-116629434 CAGAAGGAGAGGAGAGAAGGCGG + Intergenic
1103031545 12:117618474-117618496 CAGAAAGAAAGGAGGCACAGAGG - Intronic
1103136684 12:118513640-118513662 CAGAAGGAAAGCTGGCAAGGAGG - Intergenic
1103166278 12:118773256-118773278 CAGCAGGCGAGGAGACAAGGAGG - Intergenic
1103230192 12:119323583-119323605 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1103251627 12:119504990-119505012 AAGAAAGAAAGGAGGGAAGGAGG - Intronic
1103587971 12:121970320-121970342 CAGGATGACAGGAGGCAGGGAGG - Intronic
1104063475 12:125287171-125287193 CAGAAGCAGAGGAGGGAGGGAGG - Intronic
1104253312 12:127117229-127117251 CAGAGGGAAAGGAGGCAGTGGGG - Intergenic
1104559177 12:129828705-129828727 GAGAAGGAAGGGAGGAAAGGAGG + Intronic
1105284404 13:18992877-18992899 CAGAAGGCCAGCAGGAAAGAAGG + Intergenic
1105284512 13:18993447-18993469 CAGAAAGCCAGGAGGCCAGAAGG + Intergenic
1105284631 13:18994138-18994160 CAGAAAGCCAGAAGGCAAGAAGG + Intergenic
1105285032 13:18996487-18996509 AAGAAGGACAGGAAGACAGGAGG + Intergenic
1105746055 13:23377783-23377805 CAGAAGGAGACAAGGCCAGGAGG - Intronic
1106183063 13:27384607-27384629 GAGAAGGAAGGGAGGCAGGGAGG - Intergenic
1106281387 13:28275748-28275770 CAGAATGGCAGGAGGGAAGCTGG - Intronic
1106574533 13:30962379-30962401 CACAAGGCCACGAGGCATGGAGG - Intronic
1106606569 13:31234535-31234557 AAGGAGGACAGCAGGTAAGGTGG + Intronic
1106923544 13:34589702-34589724 CAGAAGGGAGGGAGGCAAGGAGG + Intergenic
1107195487 13:37646248-37646270 GAGAAGAACAGGAGGCAGGATGG - Intronic
1107436132 13:40382342-40382364 AAAAAGGACAGGAGGAAACGGGG - Intergenic
1107794445 13:44035562-44035584 GAGAAGAAAAGGAGGGAAGGAGG + Intergenic
1108822340 13:54368662-54368684 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1109278431 13:60327849-60327871 CAGAAGAACAAGAAGCAAAGAGG - Intergenic
1109576879 13:64271214-64271236 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1109759854 13:66813472-66813494 AAGAAGGAAGGGAGGAAAGGAGG + Intronic
1110290879 13:73805603-73805625 CAGAAGGAAGGGAGGGAGGGAGG + Intronic
1111883403 13:93987933-93987955 GAGCAGGACAAGAGGCAAGGAGG - Intronic
1111999466 13:95196555-95196577 TAAAAGGAAAGGAGGAAAGGAGG + Intronic
1111999468 13:95196563-95196585 AAGGAGGAAAGGAGGAAAGGAGG + Intronic
1112158159 13:96840005-96840027 AAGAAGGAAAGGAGGGAAGGGGG + Intergenic
1112350892 13:98632150-98632172 CAGAAGCCCAGCAGGAAAGGAGG + Intergenic
1112477705 13:99747380-99747402 CAGAGCGGCAGGAGGCAAGGAGG - Intronic
1112715623 13:102181536-102181558 CAGAGGCACAGGAGGAGAGGAGG + Intronic
1113069523 13:106406927-106406949 GAGCAGGACAGGAGGGAGGGAGG - Intergenic
1113361195 13:109633076-109633098 CAGAAGGTAAGGGGGCAAGGAGG - Intergenic
1113440464 13:110324364-110324386 CAGCAGGACAGGTGTCAAGAAGG - Intronic
1113891495 13:113737932-113737954 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1113910740 13:113840088-113840110 CAGCAGGCCTGGACGCAAGGTGG + Intronic
1114148539 14:20008045-20008067 CAGAAGGAAGGGAGGTAGGGAGG + Intergenic
1114415568 14:22540989-22541011 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1114773562 14:25455969-25455991 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1115450613 14:33543133-33543155 CAGAAAGAGATGAGGGAAGGAGG - Intronic
1115462607 14:33678404-33678426 AAGGATGACAGGAGGAAAGGAGG - Intronic
1115709877 14:36039215-36039237 CAGGAGGACTAGGGGCAAGGAGG + Intergenic
1115716223 14:36106818-36106840 CAGAAAGCAAGGAGGCAGGGAGG + Intergenic
1116252961 14:42510267-42510289 AAGAAAGACAGGAGGGAGGGAGG + Intergenic
1116592857 14:46802044-46802066 AATCATGACAGGAGGCAAGGAGG + Intergenic
1116659588 14:47692089-47692111 AAGAAAGAAAGGAGGGAAGGAGG - Intergenic
1117090573 14:52246062-52246084 GAGCAAGACAGAAGGCAAGGAGG - Intergenic
1117206836 14:53452006-53452028 AAGAAGGAAAGGAGGAAGGGTGG - Intergenic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1119280289 14:73401014-73401036 CAGAAGCACAGGACACAACGTGG + Intronic
1119421205 14:74508997-74509019 CCCAAGGACAGGAGTCAAGGGGG + Intronic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1120346266 14:83294206-83294228 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
1120576356 14:86186077-86186099 AAGAAAGTCAGGAGGCAGGGAGG - Intergenic
1120666361 14:87311202-87311224 CGGAAGGACGGGAGGGAGGGAGG - Intergenic
1121006954 14:90496522-90496544 GAGAAGACCAGGAGGCAAGACGG - Intergenic
1121017977 14:90559978-90560000 CAGAGGGACAGGGGCCAAGGGGG - Intronic
1121527281 14:94627874-94627896 CAGAAGGACAGGAGTCAAGGGGG + Intergenic
1121578264 14:95006664-95006686 CAGCAGGAGAGGAGGCTGGGGGG + Intergenic
1121924388 14:97914649-97914671 CAGCAGGACTGGAGGCTATGAGG - Intergenic
1122200642 14:100120627-100120649 CAGAGAGACAGGAAGCATGGTGG + Intronic
1122226741 14:100285065-100285087 GGGAGGGAGAGGAGGCAAGGAGG + Intergenic
1122272116 14:100573053-100573075 GAGAAGGATGGGAGGCAGGGTGG + Intronic
1122314585 14:100818222-100818244 GAGGAGGCCATGAGGCAAGGTGG - Intergenic
1122570468 14:102695500-102695522 AAGAAGGAAAGGAGGGAAGGAGG + Intronic
1122809315 14:104280246-104280268 CTGCAGGCCGGGAGGCAAGGAGG + Intergenic
1123042908 14:105497732-105497754 CAGAGGGACAGAGGGCAAAGAGG - Intronic
1123690479 15:22834693-22834715 TAGGAGTAGAGGAGGCAAGGAGG - Intergenic
1123874127 15:24606633-24606655 CAGAAGGAGAGTAAGCAAGGAGG - Intergenic
1124382362 15:29177502-29177524 AGGAAGGAAAGGAAGCAAGGAGG - Intronic
1124598422 15:31110906-31110928 CAGAAGGGAGGGAGGGAAGGGGG - Intronic
1124715592 15:32058180-32058202 CAGAGGGAAAGGAGGCAAGGAGG - Intronic
1124720256 15:32105467-32105489 GAGGAGGAGAGGAGGAAAGGAGG + Intronic
1124720261 15:32105486-32105508 GAGGAGGAGAGGAGGAAAGGAGG + Intronic
1124983672 15:34584778-34584800 CAGAAGGACAGGGGGCCTGGGGG + Intronic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125431069 15:39593898-39593920 CAGACAGAGAGGAGGGAAGGAGG - Intronic
1126148392 15:45499543-45499565 CAGAAGGACAGAAGGATAGAAGG + Intronic
1126226806 15:46280321-46280343 AAGAAGGAAAGGAGGGAATGAGG + Intergenic
1126638688 15:50803684-50803706 CAGAAGCACAGGTGGCAACCTGG + Intergenic
1126848782 15:52785353-52785375 AAGAAGGACCTGAGCCAAGGGGG - Intronic
1127013374 15:54655236-54655258 CAGAAGAACAGGAGGGTAAGAGG + Intergenic
1127638697 15:60894867-60894889 CACAGGCACAGCAGGCAAGGCGG + Intronic
1127688334 15:61370227-61370249 CAGAAGGACAGGTGTCAGGAAGG - Intergenic
1128301340 15:66567978-66568000 CATGAGGACAGGAGGCGAGCAGG + Intergenic
1128380312 15:67107465-67107487 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1128551533 15:68600904-68600926 CAGCAGGACAGCCGGGAAGGTGG - Intronic
1128619978 15:69140592-69140614 AAGCAGGGCAGGAGGCAAGTGGG - Intergenic
1128764247 15:70241439-70241461 CAGAGGGACAGGTGGCGAGGGGG + Intergenic
1129106070 15:73308125-73308147 CAGAAGTCCAGGGGGCAAAGGGG + Intergenic
1129618434 15:77120036-77120058 CAGAGGGATAGGGGGAAAGGTGG + Intronic
1129738416 15:77978241-77978263 CTGGAGGCCAGGAGGCAGGGAGG - Intergenic
1129847657 15:78775368-78775390 CTGGAGGCCAGGAGGCAGGGAGG + Intronic
1129933078 15:79428346-79428368 AAGAAGAAAAGGAGGCAAGGAGG - Intergenic
1130048041 15:80461307-80461329 TGGAAGGACAGGAGTCGAGGTGG + Intronic
1130226093 15:82059152-82059174 GAGAAGGAGAGGAGGGGAGGGGG - Intergenic
1130254246 15:82318541-82318563 CTGGAGGCCAGGAGGCAGGGAGG - Intergenic
1130258772 15:82338326-82338348 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130269912 15:82440777-82440799 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130380793 15:83371030-83371052 AACAAGGGCAGCAGGCAAGGGGG + Intergenic
1130462248 15:84168078-84168100 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130473868 15:84247000-84247022 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130481282 15:84361064-84361086 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130490426 15:84426695-84426717 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130502016 15:84505465-84505487 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130596151 15:85251615-85251637 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130600723 15:85271429-85271451 CTGGAGGCCAGGAGGCAGGGAGG + Intergenic
1130847145 15:87758137-87758159 AAGGAGGAAAGGAGGAAAGGAGG + Intergenic
1130847155 15:87758169-87758191 GAGAAGGAAAGGAGGGAAGGAGG + Intergenic
1130894916 15:88162463-88162485 CAGAAGGAGAGGGGAGAAGGGGG + Intronic
1131285893 15:91057118-91057140 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
1131492620 15:92876107-92876129 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1131624499 15:94103245-94103267 AAGAAAGAAAGGAGGGAAGGAGG - Intergenic
1132091369 15:98950275-98950297 CAGGTGGACAGGAGGGAATGAGG + Intronic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1132506900 16:314837-314859 CAGAGGGACAAGAGGACAGGTGG - Intronic
1132556685 16:575713-575735 CAGCAGGACAGGGGGCAGGTGGG - Intronic
1132676711 16:1124090-1124112 TGGAAGGACAGGAGGCCACGGGG + Intergenic
1132686774 16:1165545-1165567 CAGATGCACCGGAGGCCAGGTGG - Intronic
1133453434 16:5922391-5922413 CACAAGGAGATGTGGCAAGGAGG + Intergenic
1134037562 16:11042402-11042424 GAGAGGGACAGGAGGACAGGAGG + Intronic
1134244719 16:12531441-12531463 CAGATGGCCAAGAGGAAAGGGGG + Intronic
1135263331 16:21000019-21000041 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1135887703 16:26326488-26326510 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1136024930 16:27463128-27463150 CAGAGTTACAGGAAGCAAGGGGG - Intronic
1136095861 16:27955951-27955973 AGGAAGGACAGGAGGGAGGGAGG + Intronic
1136147387 16:28323441-28323463 CCGAAGGACAGGGGGCAGTGTGG - Exonic
1136667433 16:31824546-31824568 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
1137453963 16:48603965-48603987 CACAAGGATTGGAGGTAAGGGGG - Intronic
1137466410 16:48713872-48713894 CAGGAGGAAGGGAGGCAGGGAGG - Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137501569 16:49015320-49015342 CAGAGGGCCAGGTGGCAAGGTGG - Intergenic
1138032109 16:53567795-53567817 AAGAAAGACAGAAGGCGAGGTGG - Intergenic
1138147912 16:54628653-54628675 CAGAAGGAAAGAAGGGAAGCAGG + Intergenic
1138339724 16:56280778-56280800 CAGAAAGCCAGGAGGCCGGGTGG + Intronic
1138481096 16:57303936-57303958 CAGGAGGGCAGCAGGCAGGGCGG - Intergenic
1138550305 16:57744140-57744162 CAGAAGCACAGCAGGGAAGAGGG + Intronic
1138637312 16:58351465-58351487 CAGTGATACAGGAGGCAAGGAGG - Intronic
1138777741 16:59744588-59744610 GAGAAGGAAAGGAAGGAAGGGGG - Intronic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1138972060 16:62157317-62157339 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1139016256 16:62692451-62692473 AGGAAGGACGGGAGGGAAGGAGG + Intergenic
1139209511 16:65063569-65063591 CAAAAGGCCAAGAAGCAAGGAGG + Intronic
1139243487 16:65418343-65418365 CAGAAAGACAGAAAGAAAGGAGG - Intergenic
1139300596 16:65942259-65942281 AGGAAGGAAAGGAGGAAAGGAGG + Intergenic
1139300598 16:65942267-65942289 AAGGAGGAAAGGAGGAAAGGAGG + Intergenic
1139651725 16:68365592-68365614 CAGAAGGCGACGAGGCCAGGAGG - Intronic
1140228389 16:73097047-73097069 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1140379096 16:74470313-74470335 AAGAAGGAAAGGAAGGAAGGAGG - Intronic
1140474623 16:75233685-75233707 AAGATGGTCAGGAGGCAGGGGGG + Intronic
1140551466 16:75870616-75870638 CAGAAGGAGAGGAGACAAGCAGG + Intergenic
1140981042 16:80109584-80109606 CAGAAGGACACATGGGAAGGTGG + Intergenic
1141612829 16:85192800-85192822 CAGAAGGAGAGAAGGCGATGGGG + Intergenic
1141756238 16:85992961-85992983 CAGAAGGACAGAAGGGAGGAAGG - Intergenic
1141756243 16:85992985-85993007 CAGAAAGACAGAAGGGAAGAAGG - Intergenic
1141961223 16:87410752-87410774 CAGCAGGCCTGCAGGCAAGGTGG - Intronic
1142030651 16:87836809-87836831 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1142644885 17:1305209-1305231 CAGAAGCACAGTAAGCAAAGAGG - Intergenic
1142958115 17:3535048-3535070 CAGAGGGGCAGGAGGGGAGGAGG - Intronic
1143165398 17:4894942-4894964 GAGAAAGACAGGAGGAGAGGAGG - Intronic
1143192157 17:5047930-5047952 CAGAAGGACAAGAAATAAGGTGG - Intronic
1143272037 17:5683049-5683071 CAGAGGGACAGGAGGGAGAGGGG - Intergenic
1143506608 17:7369327-7369349 GAGAAGGACAGAAGGCTCGGAGG + Intergenic
1143651859 17:8268391-8268413 AAGAAGGAAAGGAAGGAAGGAGG + Intronic
1144020414 17:11236112-11236134 TAGAAGGACAGCAGGCGAGCAGG + Intergenic
1144561045 17:16320443-16320465 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1144596879 17:16577318-16577340 TGGAAAGACTGGAGGCAAGGAGG + Intergenic
1144645667 17:16971979-16972001 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146332219 17:31937080-31937102 GAGGAGGAGAGGAGGGAAGGAGG - Exonic
1146726712 17:35162212-35162234 CAGAAGCACAGGTGGCAACTTGG + Intronic
1146925026 17:36738555-36738577 CAGAAAGACAGGGAGGAAGGAGG + Intergenic
1146947659 17:36884832-36884854 CAGGAGGGGAGAAGGCAAGGGGG + Intergenic
1147411841 17:40258711-40258733 CAGAAAGAGAGGAGGGAGGGAGG + Intronic
1147464090 17:40597445-40597467 CCCCAGGACAGGAGCCAAGGAGG - Intergenic
1147491005 17:40866098-40866120 CAGTAGGACAGAAGACATGGTGG + Intronic
1147658833 17:42106274-42106296 GAGAAGGAAAGAAGGGAAGGAGG + Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1148685008 17:49496151-49496173 CAGAAGGAAAGGAGACAGAGCGG + Intronic
1148798255 17:50207864-50207886 GAAAAGGATAGGAGGCAGGGTGG + Intergenic
1148878014 17:50704043-50704065 ATGAAAGACAGGAGGCAAGCAGG + Intronic
1150224013 17:63513213-63513235 AAGAAGGAAAGGAAGAAAGGAGG + Intronic
1150387349 17:64772801-64772823 GAGAAGGCAAGGAGGCAGGGTGG + Intergenic
1150737750 17:67754777-67754799 AAGAAGGAGAGGAGGTAGGGTGG - Intergenic
1150748822 17:67840521-67840543 GAGAAGGAGAGGAGGAAAAGGGG - Intronic
1150837019 17:68573627-68573649 AAGAAAGAAAGGAGGGAAGGAGG - Intronic
1151059237 17:71071860-71071882 CAGAAGAACTGGAGGAAATGGGG + Intergenic
1151247051 17:72803176-72803198 AACAAGGGCAGGAGGCGAGGGGG - Intronic
1151328540 17:73393495-73393517 CAGATGGGCAGGAGGAAGGGCGG + Intronic
1151342615 17:73481552-73481574 CAGAAAGACAGGAGACAGAGTGG + Intronic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1153028246 18:690245-690267 CAGAAGCACAGGTGACAACGTGG + Intronic
1153030530 18:709332-709354 CAGAAAGGCAGGAGGCCACGAGG + Intronic
1153718512 18:7876617-7876639 CTGGAGGACAGGAGACAATGTGG - Intronic
1153811851 18:8759000-8759022 CAGAAGGACAAGAGGACAGCAGG + Intronic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1153953430 18:10076241-10076263 CAGGAGGTCATGAGGAAAGGAGG - Intergenic
1154025237 18:10701339-10701361 CAGAAGGACAGGAGTCCCTGAGG + Intronic
1154197814 18:12279227-12279249 CAGCAGGAGAGGAGGTGAGGAGG + Intergenic
1154975273 18:21451445-21451467 AAGAAGGAAGGGAGGGAAGGAGG - Intronic
1155028007 18:21959854-21959876 AAGAAGGACAGAAGGAAAGAAGG + Intergenic
1155978203 18:32154420-32154442 CAGAAGCTCAGGGTGCAAGGTGG - Intronic
1156461062 18:37321612-37321634 GAGAGAGACAGGAGGGAAGGGGG - Intronic
1156606400 18:38672026-38672048 CTGAAGGAGAGAAGGCAGGGTGG - Intergenic
1156623590 18:38882114-38882136 AAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1156950447 18:42890462-42890484 CAGAAGGAAAGAAGGAAAAGAGG + Intronic
1157519544 18:48336106-48336128 CAGAAAGACTGGAGGCAGGAGGG - Intronic
1157580103 18:48769108-48769130 AAGAGGGAGAGGATGCAAGGAGG - Intronic
1157599496 18:48885411-48885433 CAGGAGGAGAAGAGGCATGGCGG + Intergenic
1157788482 18:50508022-50508044 CAGAAGGACAAGAGTGAAGCTGG - Intergenic
1158028152 18:52928709-52928731 CAGAAGCACAGAAGGCAAGAGGG - Intronic
1158418108 18:57267817-57267839 CAGAAGGAAAGATGGCAGGGAGG + Intergenic
1159052740 18:63436682-63436704 CAGAAAGGCAGGGGCCAAGGTGG + Intergenic
1159418804 18:68188101-68188123 CAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1159771230 18:72547344-72547366 CAGAAGGGCAGGAGGGTAGGAGG + Intronic
1159869710 18:73746573-73746595 CAGAACAACAGGAGGCATGTTGG + Intergenic
1159902430 18:74060179-74060201 CAAAAAGACACCAGGCAAGGTGG - Intergenic
1160060785 18:75527101-75527123 CAGAAAGACAGGAGGGAGAGAGG - Intergenic
1160776582 19:859413-859435 CAGATGGGCAGGAGGCAGAGAGG - Intergenic
1160963632 19:1735915-1735937 GAGGAGGCCAGGAGGGAAGGGGG + Intergenic
1160969730 19:1762256-1762278 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1161372455 19:3920780-3920802 CAGAAGATCAGGAAACAAGGTGG + Exonic
1161410333 19:4113418-4113440 CAGATGGACAGGAGGGGAGGGGG + Intronic
1161427722 19:4213238-4213260 AAGAAGGAAAGGAAGGAAGGAGG - Intronic
1161584472 19:5097729-5097751 CAGAAGAACAAAAGGGAAGGTGG - Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161766123 19:6209905-6209927 AGGAAGGAAAGGAGGAAAGGAGG - Intergenic
1161982342 19:7636728-7636750 CTGAAGTACAGAAGGCAAGTGGG + Intronic
1161995855 19:7710802-7710824 AAGAAAGAAAGGAGGCAGGGAGG - Intergenic
1162048996 19:8020871-8020893 GAGAAAGAAAGGAGGGAAGGAGG - Intronic
1162537734 19:11273607-11273629 AAGAAGGACAGAAGGAAAGAAGG - Intergenic
1162907397 19:13831848-13831870 CAGAAAGACAGGAGGCGAAAGGG - Exonic
1162968654 19:14167486-14167508 CAGGAGGGCAGCAGGCAGGGTGG - Intronic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163061275 19:14763932-14763954 GAGGAGGACAGGAGGAGAGGAGG - Intronic
1163716532 19:18875869-18875891 CAGAAGCCCAAGAGGCAAGGAGG + Intronic
1163805099 19:19391328-19391350 GAGAAAGAAAGGAGGGAAGGAGG - Intronic
1164292475 19:23880502-23880524 AAGAAGGACAGGGGGAGAGGAGG + Intergenic
1164540769 19:29120044-29120066 CAGCAGGACCAGAGGCATGGAGG + Intergenic
1164744235 19:30599386-30599408 AAGAAGGAAGGGAGGAAAGGAGG - Intronic
1164816058 19:31204338-31204360 AGGAAGGACGGGAGGGAAGGAGG - Intergenic
1164826421 19:31287871-31287893 CAGGAGGAAAGGAGGCCCGGAGG - Intronic
1164853613 19:31503879-31503901 GAGGAGGAAAGGGGGCAAGGAGG + Intergenic
1164882310 19:31742660-31742682 ATGAAGGACAGGAGGGAGGGAGG + Intergenic
1164972546 19:32544901-32544923 CAGGAAAACAGGAGGCCAGGAGG - Intergenic
1165375053 19:35435977-35435999 CAGAAAAACAGGGGGCAGGGAGG - Intergenic
1166069591 19:40379344-40379366 CAGAAGGACAGCAGGAAAGGGGG - Exonic
1166088746 19:40494303-40494325 AAGGAGGAAAGGAGGGAAGGAGG - Intronic
1166115536 19:40651549-40651571 AAGAAAGAAAGGAGGGAAGGAGG + Intergenic
1166118128 19:40667915-40667937 CTGCAGGGCAGGAGGCATGGTGG + Exonic
1166654491 19:44600206-44600228 CAGGAACACAGGAGGCAAGGAGG + Intergenic
1166714957 19:44961070-44961092 CAGAATGACAGAAGGGAAGGGGG - Intronic
1167087984 19:47323777-47323799 GAGAAGGCCAGGAGGCCAGGAGG - Intergenic
1167435215 19:49475062-49475084 GAGATGGACAGGAGGGAAGATGG + Intronic
1167598207 19:50438331-50438353 CAGATAGACAGGTGGGAAGGTGG + Intronic
1167603544 19:50467903-50467925 CAGAGGGAGGGGTGGCAAGGTGG - Intronic
1168328784 19:55553918-55553940 GAGAAAGAAAGGAGGGAAGGAGG - Intergenic
1168357411 19:55710625-55710647 CAGGAGGAAAGGAAGCAGGGGGG - Intronic
1168464982 19:56594989-56595011 AGGAGGGACAGGAGGGAAGGGGG - Intergenic
1202694767 1_KI270712v1_random:115971-115993 CAGAGGCACAGGAGGCCATGGGG + Intergenic
925011126 2:487311-487333 CAGAAGAACAGGCTGCAGGGAGG - Intergenic
925078512 2:1040391-1040413 GAGAAAGACAGGAGGAAAGAGGG - Intronic
925466462 2:4110878-4110900 GAGAAGGGAAGGAGGGAAGGTGG - Intergenic
925696100 2:6580800-6580822 CAGAAGGACAGCAGTCATAGTGG + Intergenic
925972939 2:9120066-9120088 AAGATGGACAAGAGACAAGGTGG + Intergenic
926138587 2:10355020-10355042 CAGAAGGACAGGAAGCAAAGTGG + Intronic
926425616 2:12736269-12736291 CAGAAGGACTGGGGTCAAGCAGG + Intronic
926425727 2:12737006-12737028 CAGAAGGACTGGGGCCAAGCTGG + Intronic
926433123 2:12810005-12810027 AGGAAGGACAAGAGGCAAAGAGG + Intergenic
928405451 2:31011051-31011073 CAGAAGCACAGGAAGGAGGGAGG + Intronic
928434864 2:31248461-31248483 GTGCAGGACAGGAGGCCAGGAGG - Intronic
928507129 2:31965290-31965312 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
928902561 2:36336002-36336024 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
928921898 2:36535162-36535184 AAGGAGGACAGGAGGGAGGGAGG + Intronic
928930784 2:36621517-36621539 CAAAAGGAAAGGAGGAAGGGAGG + Intronic
929095471 2:38259509-38259531 CAGAAGGACAGGGGGAAATGGGG + Intergenic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929311506 2:40431396-40431418 ATGAAGGACTGTAGGCAAGGAGG + Intronic
929442287 2:41973553-41973575 CACAAGGCAAGGAGGAAAGGAGG + Intergenic
929654491 2:43717039-43717061 GAGAAGGACATGGGGCCAGGAGG + Intronic
929825478 2:45306463-45306485 CAGAAGTACAGGTGGCAAGTTGG - Intergenic
930406269 2:50960334-50960356 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
930589830 2:53314001-53314023 AAGAAGAAAAGGAGGGAAGGAGG + Intergenic
930639355 2:53839555-53839577 GAGAGAGACAGGAAGCAAGGAGG - Intergenic
931150814 2:59571140-59571162 AGGAAGGAAAGAAGGCAAGGAGG + Intergenic
931939704 2:67238707-67238729 CAGAAGGACAAGTGGCAAAAGGG + Intergenic
932195164 2:69776917-69776939 CAGAAGCACAGGTGACAAGCTGG - Intronic
932401857 2:71486269-71486291 AAGAGGGAGGGGAGGCAAGGTGG - Intronic
932576164 2:72963521-72963543 CAGTAGGACAGGGGGAAGGGAGG + Intronic
932644366 2:73486081-73486103 AAGAGGGACAGGAGCCAAGATGG - Intronic
933390179 2:81657545-81657567 AAGCAAGACAGGAAGCAAGGGGG - Intergenic
933578363 2:84096073-84096095 AAGAAAGAAAGGAGGAAAGGGGG + Intergenic
933976423 2:87515569-87515591 CTGAAGGATGGAAGGCAAGGGGG + Intergenic
934275939 2:91573020-91573042 CAGAGGCACAGGAGGCCATGGGG + Intergenic
934688818 2:96341691-96341713 CTGAAGGAGAGGAGGCACTGTGG - Exonic
934713120 2:96528336-96528358 CAGAAGGAGGGAAGGCAAGGGGG + Intergenic
935339388 2:102046132-102046154 AAGAAGAAAAGGAGGAAAGGAGG + Intergenic
935663470 2:105489212-105489234 CAGAAGGAAGGGAGGCAGGGAGG + Intergenic
935980887 2:108625686-108625708 CTGCAGGAAAGGAGGAAAGGAGG - Intronic
936056325 2:109264614-109264636 CAGGAGGTCAGGAGTCTAGGTGG + Intronic
936317396 2:111435236-111435258 CTGAAGGATGGAAGGCAAGGGGG - Intergenic
936715356 2:115180901-115180923 CAGGAGGAAGGGAGGCATGGAGG - Intronic
936780497 2:116027184-116027206 CAGAAGCTCAGGAGGTAATGAGG + Intergenic
936949299 2:117961755-117961777 CAGAAGGAGAAGAGGAAAAGGGG + Intronic
937117669 2:119420203-119420225 GAGAAGGACATGAGACATGGGGG - Intergenic
937233778 2:120418279-120418301 CTTGAGGACAGGAGGCAAAGTGG + Intergenic
937430682 2:121835716-121835738 CAGAAGGGGAGGAGGGGAGGAGG - Intergenic
937603443 2:123768312-123768334 CGGAAGGAAAGAAGGCAGGGAGG - Intergenic
938240266 2:129737934-129737956 CAGGAGGGCAGGAGGGCAGGAGG - Intergenic
938244424 2:129765930-129765952 CAGAAGGAAAGGAGGCAGTGGGG - Intergenic
938747423 2:134292914-134292936 CAGAAGGCCAGGCTTCAAGGTGG + Intronic
938860583 2:135364091-135364113 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
938959151 2:136325339-136325361 CAGAAGAACAGCAGGAAAAGAGG + Intergenic
939125509 2:138172944-138172966 CAGGAGGAAAGGGGGCAGGGAGG - Intergenic
941000094 2:160193665-160193687 CAGAAGGAAAGGAGGAAAATAGG - Intronic
941753757 2:169162830-169162852 CAGCAGCACAGGAGACACGGAGG - Intronic
942289427 2:174454655-174454677 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
943016454 2:182516666-182516688 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
943575940 2:189631108-189631130 AAGAAGGAAGGGAGGAAAGGTGG + Intergenic
944245857 2:197529942-197529964 AATAAGGCCAGGAGGCCAGGTGG - Intronic
944406750 2:199393253-199393275 AAGAAGAAAAGGAGGGAAGGAGG + Intronic
944593024 2:201236162-201236184 CAGGAGGACAGGATTCAAGAGGG - Intronic
944809050 2:203310010-203310032 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
944963103 2:204899216-204899238 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
945240795 2:207675056-207675078 CATAAGAACAGAAGGCAAGTAGG + Intergenic
946163043 2:217847670-217847692 CGGAAGGAAGGCAGGCAAGGAGG + Exonic
946658160 2:221971199-221971221 AAGGAGGAGAGAAGGCAAGGTGG - Intergenic
946790955 2:223300024-223300046 CTGGAGGACAGAAGGCATGGTGG - Intergenic
946899931 2:224362304-224362326 GAGGAGGAAAGGAGGAAAGGTGG + Intergenic
947629907 2:231645392-231645414 AGGAAGGACAGGAGGGAGGGAGG - Intergenic
947926900 2:233929371-233929393 CAGAAGGTGAGAAGGGAAGGGGG + Intronic
948176734 2:235949465-235949487 CAGAAGAACAGGCGGAGAGGTGG - Intronic
948486252 2:238283131-238283153 TTGCTGGACAGGAGGCAAGGAGG + Intronic
948815912 2:240510260-240510282 GAGGAGGGCAGGAGGCAGGGAGG - Intronic
948815927 2:240510304-240510326 GAGGAGGGCAGGAGGCAGGGAGG - Intronic
949007130 2:241656093-241656115 CAGAAGGAGAGGCTTCAAGGGGG - Intronic
1168885191 20:1245960-1245982 GAAAAGGATAGGAAGCAAGGAGG + Intronic
1168983999 20:2032052-2032074 CAGCAGGAGAGAAGGCAGGGGGG - Intergenic
1169391706 20:5196250-5196272 CAGAAGGACAGGAGGGCTCGGGG - Exonic
1169400496 20:5275282-5275304 CAGGAGGCCAGGAGGCTGGGAGG - Intergenic
1169964601 20:11201783-11201805 CAGAAGGTCAAGAGGCAAAAAGG + Intergenic
1170278492 20:14619505-14619527 AAGGAGGAAAGGAGGGAAGGAGG + Intronic
1170369451 20:15632822-15632844 AAGAAGGAGAGGAGGGAAGGAGG - Intronic
1170700073 20:18695605-18695627 GAGAAGGAAAGAAGGGAAGGGGG - Intronic
1170790221 20:19502247-19502269 CAGAAAGAAAGGAGTCAAAGAGG + Intronic
1170872607 20:20220479-20220501 CAGAAGTACAGGTGGCAACATGG + Intronic
1171302901 20:24079184-24079206 CAGCGGGAGAAGAGGCAAGGAGG + Intergenic
1171733119 20:28736647-28736669 CAGAAGAACAAGAGCCAAGATGG + Intergenic
1171868407 20:30507195-30507217 AAGAAGGAAAGGAGGAAGGGAGG + Intergenic
1172104588 20:32509105-32509127 CAGAAGGACACGTGGCACTGGGG - Intronic
1172554731 20:35831148-35831170 GAGAAGGAAAGGAGGGAGGGAGG - Intronic
1172938873 20:38641062-38641084 GAGAAGGAAAGAAGGGAAGGAGG + Intronic
1172992560 20:39047452-39047474 TGGAAGGACAGGAGGGAGGGAGG - Intergenic
1173144560 20:40513538-40513560 AAGAAACACAGGAGGCAAGATGG - Intergenic
1173190559 20:40872554-40872576 CAGAAGGACATGAGGAAAGGTGG - Intergenic
1173198296 20:40934161-40934183 AAAAAGGACAGGGAGCAAGGAGG + Intergenic
1173234091 20:41228000-41228022 CAGAAGGAGAGGAAGGAATGGGG - Intronic
1173249750 20:41358204-41358226 CAGAACCACAGCAGGGAAGGGGG - Intronic
1173252295 20:41370358-41370380 CAGAAGCAGAGGAGGAAAGGAGG + Intergenic
1173821654 20:46023503-46023525 GGGAAGGACTGGAGGCAGGGAGG - Intronic
1174123498 20:48285631-48285653 CAGTGGGAGAGGAAGCAAGGCGG + Intergenic
1174130650 20:48341472-48341494 AGGAAGGAGAGGAGACAAGGAGG - Intergenic
1174275515 20:49401002-49401024 CAGATGGACAGGTGGATAGGTGG - Intronic
1174548839 20:51346301-51346323 CAGAGGGCCAGGAGGCAGGTAGG + Intergenic
1174786358 20:53436841-53436863 CAGGAGGAAAGGAGGCTGGGTGG - Intronic
1175157255 20:56979445-56979467 CAGAAGGACTGAAGGCAGTGTGG + Intergenic
1175388865 20:58614001-58614023 TGGAAGGACAGGAGGCAGTGGGG - Intergenic
1175413344 20:58785691-58785713 AAGAAAGAGAGGAGGGAAGGGGG + Intergenic
1175451783 20:59075753-59075775 CAGAGAGACAGGAGGCCAGGTGG + Intergenic
1175540940 20:59747213-59747235 CAGATGGACAGGAAGGGAGGAGG - Intronic
1175668734 20:60882749-60882771 GGGGTGGACAGGAGGCAAGGAGG - Intergenic
1175709320 20:61206453-61206475 CAGAAGAACAGGAAGGAAGGAGG + Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176244153 20:64089461-64089483 TAGGAGGACAGGAAGAAAGGAGG - Intronic
1176952037 21:15059522-15059544 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1177182591 21:17758925-17758947 CACCAGGACAGGAAGCAAGAGGG - Intergenic
1177240119 21:18444846-18444868 TGGAAGGAGAGGAGGTAAGGGGG - Intronic
1178319885 21:31597250-31597272 AAGAAGGGAGGGAGGCAAGGAGG - Intergenic
1178320602 21:31602286-31602308 GAGAGGGAAAGGAGGCAGGGCGG + Intergenic
1178337879 21:31759937-31759959 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1178572424 21:33751644-33751666 CAGGAGGACAGAGGGTAAGGAGG + Intronic
1180258820 21:46651925-46651947 CAGGCAGACAGCAGGCAAGGAGG - Intronic
1180577380 22:16791689-16791711 GAGAAAGAAAGGAGGCAGGGGGG + Intronic
1180902762 22:19386586-19386608 GAGAAGGGCAGGAGCCAAGATGG - Intronic
1181311796 22:21948925-21948947 CCCAAGGTCAGGAGGCAAGAAGG - Intronic
1181531110 22:23518025-23518047 GAGAATGAAAGGAGGAAAGGAGG + Intergenic
1182016419 22:27043960-27043982 AAGAAGGACAAAAGGGAAGGAGG - Intergenic
1182486776 22:30643843-30643865 TAGAAGGAGAGGTGGCAATGAGG + Intronic
1182525647 22:30916675-30916697 AAGAAGGAAAGGAGGCAGGAAGG + Intergenic
1182555958 22:31128392-31128414 AAGAGGGGCAGGAGGCAAGGTGG + Intronic
1182713043 22:32334507-32334529 CAGCAGGAATGGAGGCAGGGAGG - Intergenic
1182718178 22:32376677-32376699 CAGGAGGACAGGAGCCATGGTGG - Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1183164486 22:36137237-36137259 CAGCAGGACAGGAGGAATTGAGG + Intergenic
1183310788 22:37108512-37108534 CAGAAGGGCAGGAGGGAGTGAGG - Intronic
1183334335 22:37237989-37238011 CTGAATGACAGGAAGCAGGGAGG + Intronic
1183782400 22:40007275-40007297 GAGGAGGAGAGGAGGAAAGGAGG - Intronic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
1184400304 22:44270072-44270094 CAGCAGGAATGGAGGCAGGGAGG - Intronic
1184445515 22:44544773-44544795 CAGCAGGACATGGGGCTAGGGGG - Intergenic
1184652483 22:45925562-45925584 GAGAGGGACAGGAGGCAGGGAGG - Intronic
1184863945 22:47192347-47192369 CAGAAGGACAGGGGGCGGGGGGG - Intergenic
1184900767 22:47445181-47445203 CAGGAGGACAGGAGGATAGGTGG - Intergenic
1184900778 22:47445229-47445251 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900807 22:47445358-47445380 CAGGAGGACAGGTGGACAGGTGG - Intergenic
1184900832 22:47445491-47445513 CAGACGGTCAGGAGGATAGGTGG - Intergenic
1184900840 22:47445531-47445553 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900847 22:47445563-47445585 CAGGAGGACAGGCGGACAGGTGG - Intergenic
1184900856 22:47445619-47445641 CAGGAGGTCAGGAGGATAGGTGG - Intergenic
1184900858 22:47445627-47445649 CAGGAGGACAGGAGGTCAGGAGG - Intergenic
1184900864 22:47445659-47445681 CAGAAGAACAGGTGGATAGGTGG - Intergenic
1184930394 22:47676948-47676970 CAGAAGGTCTGGAGGCTTGGGGG - Intergenic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
949608221 3:5677174-5677196 GAGAAAGAAAGGAGGAAAGGAGG + Intergenic
949928759 3:9061723-9061745 CTGGAGGACAGGAGGGAGGGAGG + Intronic
950007628 3:9701697-9701719 CACAAGGACAGGTGGTATGGAGG + Intronic
950043388 3:9934059-9934081 CTGAAGGAGAGGAGGCCAGAGGG - Intronic
950284243 3:11732335-11732357 CAGAAGGAAGGAAGGCAGGGAGG - Intergenic
950444690 3:13029825-13029847 GACAAGGAAAGGAGGCAGGGAGG - Intronic
950585126 3:13886864-13886886 AAGAAGGAGAGGTGGGAAGGAGG + Intergenic
950933135 3:16811213-16811235 CAGAGGGTCAGGAAGCCAGGAGG + Intronic
950980757 3:17302110-17302132 CAGAAGCAGGAGAGGCAAGGAGG - Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
952047712 3:29344120-29344142 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
952145334 3:30525986-30526008 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
952373988 3:32749900-32749922 AGGAAGGAAAGGAGGGAAGGAGG + Intronic
952597136 3:35031783-35031805 TAGAAGGACAGAAGGCAATATGG + Intergenic
953045933 3:39294270-39294292 CAGAAGACCAGGAGGCCAGGTGG + Intergenic
953496311 3:43390280-43390302 CAGAAGGGCAGTGGGGAAGGAGG - Intronic
953901659 3:46847057-46847079 CCCAAGGACCGGAGCCAAGGTGG + Intergenic
953927303 3:46989017-46989039 CAGAGGGAGAGGGGACAAGGAGG + Intronic
954326357 3:49866346-49866368 CAGAAAGAGAGGAGGCCAAGTGG + Intronic
954708922 3:52495438-52495460 CAGAAGGCCAGGAGGCAGAGTGG - Exonic
954788016 3:53109156-53109178 GAGAATGACAGGAGCCAAGGTGG - Intronic
954806690 3:53224737-53224759 CAGACGGTCAGGAGGACAGGTGG + Intronic
954857119 3:53653742-53653764 CAGAAGGAGAGGAGAGAAAGAGG + Intronic
955100327 3:55842885-55842907 CAGAAGGAAAGCAGGTAAGAAGG + Intronic
955293676 3:57715783-57715805 CAAAAGTACAGGTGGCAAGCTGG + Intergenic
955390894 3:58521508-58521530 CAGAAGGCCTGGAGACAAGTGGG - Intronic
956741233 3:72277877-72277899 AGGAAGGAAAGGAGGAAAGGAGG - Intergenic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
957116899 3:76037883-76037905 CTGAATGACAGGGGTCAAGGAGG + Intronic
958117085 3:89234678-89234700 AGGAAGGAAAGGAGGAAAGGAGG - Intronic
959254511 3:103992012-103992034 CACGAGGAGAGGAGGTAAGGAGG + Intergenic
959502209 3:107119299-107119321 AAGAGGGAGAGGAGCCAAGGAGG + Intergenic
959627119 3:108465176-108465198 GAGAATGACAGGGGGTAAGGAGG + Intronic
960118241 3:113919675-113919697 CATCAGGACAGGTGGCAAGCTGG - Intronic
960360410 3:116704233-116704255 CAGAAGGACAGGAGAGAAACAGG + Intronic
960554565 3:119013129-119013151 TAGAAGTTCAGGAAGCAAGGAGG - Intronic
960596520 3:119412545-119412567 GACAAGGACAGCAAGCAAGGTGG + Intronic
961336545 3:126183626-126183648 AACAAGGACAGGAGGCATGCAGG - Intronic
961347733 3:126274937-126274959 CAGAAGGTAAGAAGGAAAGGGGG - Intergenic
961410162 3:126714598-126714620 CAGAAGGACAGGCTTCCAGGAGG - Intronic
961881824 3:130067042-130067064 AAGAAAGAAAGGAGGGAAGGAGG - Intergenic
961966005 3:130903618-130903640 CAGAAGGAAAGAAGGGAGGGAGG - Intronic
962369040 3:134805527-134805549 CAGGAGGGCAGGAGGCAAGGTGG - Intronic
962518995 3:136180735-136180757 GAGGAGGAGAGGAGGGAAGGAGG + Intronic
962896707 3:139721991-139722013 CAGAGGCACATGAGGCATGGGGG + Intergenic
962918212 3:139927779-139927801 CCAAAGGCCAGTAGGCAAGGTGG + Intergenic
963073502 3:141324687-141324709 AAGAAAGACAGGTGGAAAGGAGG + Intronic
963103319 3:141625223-141625245 CAGAGGCACAGGATGCAATGGGG + Intergenic
963931913 3:151012463-151012485 CTGGAGGCCAGAAGGCAAGGGGG - Intergenic
964085467 3:152812306-152812328 CAGAAGTGCAGGGGGCAGGGTGG - Intergenic
964835135 3:160929863-160929885 CTGAAGGAGAGGTGGGAAGGTGG - Intronic
965083887 3:164069463-164069485 CAGGAGGGAAGGAGGGAAGGTGG + Intergenic
966395280 3:179495616-179495638 AAGAAAGAAAGGAGGCAGGGAGG + Intergenic
966855868 3:184193517-184193539 CTGAAAGACAGGAGGGCAGGAGG - Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967278014 3:187795445-187795467 GAGAAGGAAAGAAGGAAAGGAGG + Intergenic
968482065 4:837675-837697 CAGAAGGTCAGGTGGGGAGGAGG - Intergenic
968522557 4:1040637-1040659 CAGAGGGGCACGTGGCAAGGGGG + Intergenic
968937149 4:3617367-3617389 TGGAAGGACAGGAGGGAAGAAGG - Intergenic
968943587 4:3652107-3652129 CAGAAGCACAAGGGGCAAGGTGG - Intergenic
969069486 4:4523719-4523741 GAGAAGGACTGGCAGCAAGGAGG - Intronic
969373395 4:6748007-6748029 AAGAAGCACAGGAGGCGAGGGGG + Intergenic
969682910 4:8653074-8653096 GAGAAGGGCAGGAGGGAGGGAGG - Intergenic
970301742 4:14688440-14688462 AAGAAAGAAAGGAGGGAAGGAGG + Intergenic
970488198 4:16545217-16545239 CAGAAGGAAGGGAGGGAGGGGGG - Intronic
970681873 4:18518196-18518218 CAGAAGGAAAGGAAGAAGGGAGG - Intergenic
972746222 4:41935206-41935228 CAGAAAGACGGGAGCGAAGGTGG - Exonic
972797720 4:42438667-42438689 CAGATGGACTGAATGCAAGGAGG + Intronic
972990070 4:44813965-44813987 ACGAAGGACAGGAGGCACTGTGG + Intergenic
973200175 4:47491711-47491733 GAAAAGGCAAGGAGGCAAGGAGG - Intronic
973238749 4:47934273-47934295 CATAAGGACAGGAGTGAGGGTGG - Intronic
973744324 4:53948372-53948394 AAGAAGGACAGGAGAGAAGGAGG + Intronic
974669158 4:65005822-65005844 CAGAAGGACAGGTGTCCAGATGG - Intergenic
974880402 4:67749674-67749696 ACGAAGGAAAGGAGGCAGGGAGG - Intronic
975089240 4:70381418-70381440 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
976512534 4:85928311-85928333 CGGGAGGAAAGGAGGGAAGGAGG - Intronic
976512537 4:85928319-85928341 AGGAAGGACGGGAGGAAAGGAGG - Intronic
976858910 4:89639519-89639541 AAGAAGGAAAGGAGGAAAGAAGG + Intergenic
977451659 4:97206750-97206772 AAGAAGGAAGGGAGGGAAGGAGG - Intronic
977619974 4:99125253-99125275 CAGATGGAAAGGTGGCAATGAGG - Intronic
977655211 4:99513641-99513663 AATGAGGGCAGGAGGCAAGGAGG - Intronic
977665367 4:99640902-99640924 CACAAGTACAGGGGGGAAGGAGG + Exonic
977798613 4:101198530-101198552 CAGGAGCACAGAAGGGAAGGAGG + Intronic
979032421 4:115666302-115666324 AAGAAGGAAGGGAGGCAAGGAGG - Intergenic
979111626 4:116764303-116764325 CAAAAGGAAAGGAAGGAAGGAGG + Intergenic
979187104 4:117810818-117810840 CTGAACGACAGGAGGCAGGAGGG - Intergenic
979923045 4:126524952-126524974 CAGAAGCCCAGGAGGAAAAGTGG - Intergenic
979994316 4:127412148-127412170 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
981864501 4:149399407-149399429 CACAAGGCCAGGAGGAAGGGAGG + Intergenic
981926484 4:150146037-150146059 AAGATGAACAGGAGGCTAGGAGG - Intronic
982623306 4:157732621-157732643 CTGAAGGAGAGAAGGCAGGGTGG + Intergenic
982846018 4:160253358-160253380 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
983365072 4:166776086-166776108 CAGAGGGACAGAAGGAGAGGAGG + Intronic
983516553 4:168663300-168663322 CAGAAGGCCAAGGAGCAAGGGGG + Intronic
983552547 4:169032371-169032393 AAGAAGGAAAGAAGGGAAGGAGG - Intergenic
984224956 4:177023529-177023551 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
984224990 4:177023784-177023806 AAGAAAGAAAGGAGGGAAGGAGG + Intergenic
984513352 4:180707196-180707218 CTGAAGGAGAGGAGGTAATGGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985553404 5:544412-544434 CAGCAGGACAGGAGGCATCGAGG + Intergenic
985797405 5:1973164-1973186 AGGAAGGACAGGAAGGAAGGAGG - Intergenic
985944154 5:3163691-3163713 TAGAAGGGCAGGAGCCAGGGTGG + Intergenic
985993779 5:3584932-3584954 AAGAAGGACAGGAGGAAGGAAGG + Intergenic
986049661 5:4076976-4076998 CAGGAGGAAAGAAAGCAAGGAGG - Intergenic
986179316 5:5378598-5378620 CACAAGCACAGGAGGGAAGAAGG + Intergenic
987254518 5:16136814-16136836 CAGAAAGAAAGGATGGAAGGTGG + Intronic
989141986 5:38210588-38210610 TAGAAAGAGAGGAGGAAAGGGGG + Intergenic
989531203 5:42510141-42510163 GAGAAAGAAAGGAGTCAAGGGGG - Intronic
989784074 5:45305824-45305846 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
989795962 5:45472610-45472632 AAGAAGGAAAGAAGGAAAGGGGG + Intronic
990320911 5:54628832-54628854 CAGAAGGACAGGCAGAAAGGAGG - Intergenic
990752158 5:59028557-59028579 CTGAAGCACAGAAGGCAACGTGG + Intronic
990830883 5:59955772-59955794 CCGAAGGGCAGGAGGGAGGGAGG - Intronic
990981754 5:61607645-61607667 AAGGAGGTCAGGAGGCTAGGAGG + Intergenic
991024352 5:62014131-62014153 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
991235006 5:64383967-64383989 TAGAAGGAAGGGAGGCAAGGAGG + Intergenic
991497009 5:67236661-67236683 CAGGAGGACAGGTTGCAGGGTGG + Intergenic
992440076 5:76790113-76790135 CAGCAAGAGAGGAGGCAACGTGG + Intergenic
992629870 5:78669561-78669583 AAGGAGGAAAGGAGGAAAGGAGG + Intronic
992955298 5:81901878-81901900 CAGACGGACAGGAGGGAGGCAGG + Intergenic
993699288 5:91099319-91099341 AACAAGGAGAGGAGGCAAAGAGG - Intronic
993903503 5:93599698-93599720 CAAAAGGAGAGGAGGCCTGGTGG - Intergenic
994049589 5:95347323-95347345 CAGGGGGAAAGGAGGCCAGGTGG + Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
995098596 5:108270952-108270974 GAGAAGGAGAGGGGGAAAGGGGG - Intronic
995837150 5:116410226-116410248 CAAAAGAGCAGGTGGCAAGGAGG + Intronic
996411307 5:123162244-123162266 CACACGGACAGGAGGCATTGAGG + Intronic
997332437 5:133074770-133074792 CAGAAGTATAGAAGGCAAGGAGG + Intronic
997677797 5:135726464-135726486 AAGAAGGAATGGAGGCAAGAGGG - Intergenic
998108189 5:139481736-139481758 CAGAAGGGCAGGAGGGCAAGGGG - Intronic
998632580 5:143916134-143916156 AAGAAGTAGAGGAAGCAAGGAGG + Intergenic
998802504 5:145884089-145884111 CAGCAGGACAGGAAGCAAAGTGG + Intergenic
999054355 5:148557852-148557874 AAGAATGACAGGAAGCAAGGAGG + Intronic
999423555 5:151466182-151466204 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
1000416999 5:160994163-160994185 CAGGAGGAGAGAAGGCAGGGTGG - Intergenic
1000662980 5:163959159-163959181 GAGAAAGAAAGGAGGCATGGAGG - Intergenic
1000731412 5:164838718-164838740 CGGAAGGAAAGAAAGCAAGGGGG - Intergenic
1001019442 5:168170524-168170546 GAGAAAGACAGGAGGGAGGGAGG + Intronic
1001272511 5:170325662-170325684 CAGAAGAAAAGGAGGAATGGAGG + Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001667513 5:173445529-173445551 ATGAAGGAAAGGAGTCAAGGAGG + Intergenic
1001974198 5:175983567-175983589 CAGAAGTACAGGTGACAATGTGG - Intronic
1002243235 5:177860212-177860234 CAGAAGTACAGGTGACAATGTGG + Intergenic
1002885377 6:1289335-1289357 AAGCAGGACAGGTGCCAAGGGGG + Intergenic
1003274649 6:4639140-4639162 CAAAAGAAGAGGAGCCAAGGTGG - Intergenic
1003679857 6:8242216-8242238 TAAAAGCACAGGGGGCAAGGAGG - Intergenic
1003712172 6:8603970-8603992 AAGAAAGACAGGAGGAAGGGAGG - Intergenic
1003961938 6:11216777-11216799 CAAATGGAAAGGAGGCAAGGCGG - Intronic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1004427280 6:15514861-15514883 CTACAGGACAGGAGGCAGGGCGG - Intronic
1004442594 6:15668207-15668229 CTGAAGAACAGGAGAGAAGGGGG + Intergenic
1004637099 6:17479513-17479535 AAGAAGGAAAAGAGGCAAGGAGG + Intronic
1005330262 6:24742779-24742801 CAGAGAGGGAGGAGGCAAGGTGG + Intergenic
1006000673 6:30962783-30962805 AAGAAAGACAGGAAGGAAGGAGG + Intergenic
1006307898 6:33235705-33235727 AACAAGGACAGGAGGCAGGCTGG + Intergenic
1006324687 6:33344871-33344893 CAGAAGCAGAGGAGGTGAGGGGG - Intergenic
1007348692 6:41252394-41252416 AAGAAGGAAAGGAGGAAAGGAGG - Intergenic
1007622490 6:43223488-43223510 CAGAAGGAAAGGCAGCAAAGCGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007958211 6:45936032-45936054 CAGAGGGAGAGGAGTCAAGGAGG - Intronic
1008628638 6:53343194-53343216 AAGAAGGAAAGGAGGGAGGGAGG - Intronic
1008780961 6:55104115-55104137 GAGAATGATGGGAGGCAAGGAGG + Intergenic
1008786027 6:55169275-55169297 ATGCAGGACAGGAGGCAAGATGG + Intronic
1008803071 6:55393652-55393674 AGGAAGGAAAAGAGGCAAGGGGG + Intronic
1009820930 6:68800215-68800237 CAGAAAAAGAAGAGGCAAGGAGG + Intronic
1010331635 6:74629971-74629993 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1010949407 6:82017332-82017354 CAAAGGAACAGGAGGAAAGGGGG + Intergenic
1011128293 6:84029906-84029928 CAGAAGGCCAAGAGGCAGGGAGG - Intergenic
1011222226 6:85066896-85066918 AGGAAGGAAAGGAGGGAAGGAGG + Intergenic
1011384937 6:86785614-86785636 CAGAATGACATGAGGCAAATGGG - Intergenic
1012734180 6:102918007-102918029 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1012734207 6:102918105-102918127 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1013536911 6:111071385-111071407 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1013701740 6:112779373-112779395 CAGAAGGGCAGAAGGAATGGAGG - Intergenic
1015383942 6:132600886-132600908 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1015384012 6:132601106-132601128 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1015397276 6:132749136-132749158 CAAAAGGACATGGGTCAAGGAGG - Intronic
1015573209 6:134643593-134643615 GAGAAGGCCAGGAGACAAGGAGG + Intergenic
1015789507 6:136952302-136952324 AAGACAGACAGGAGGAAAGGAGG + Intergenic
1015799540 6:137046304-137046326 CAGGAGGACAGGATGTGAGGTGG - Intergenic
1015890512 6:137965468-137965490 AAGAAAGAAAGGAGGAAAGGAGG + Intergenic
1015998506 6:139018829-139018851 AAGGAGGACAGGAGGGAGGGAGG + Intergenic
1016393336 6:143597010-143597032 CAGAAACGCAGGAGGGAAGGAGG - Intronic
1016534232 6:145092692-145092714 AAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1016722862 6:147323052-147323074 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1017079919 6:150658089-150658111 CAGGAAGAAAGGAGACAAGGCGG - Intronic
1017730170 6:157308632-157308654 CAGCAGAAGAGGAGGCAAGACGG + Intronic
1017739294 6:157392679-157392701 TAGAAGGATTGGAGTCAAGGGGG - Intronic
1017783024 6:157731332-157731354 AGGAAGGACGGGAGGCAAGAAGG + Intronic
1017988568 6:159466376-159466398 GAGGAGAACAGAAGGCAAGGTGG + Intergenic
1018062630 6:160102658-160102680 AAGAAGGAGAGGAGGTAAGCGGG + Exonic
1018216571 6:161533980-161534002 GAGGAGGACAGGTGGAAAGGGGG - Intronic
1018409495 6:163528990-163529012 CAGAAGAACAGGAGACAAGATGG - Intronic
1018650415 6:165987820-165987842 CAGATGGAAAGGAGGGAAGGAGG - Intergenic
1018884054 6:167917455-167917477 CAGAAGGACTAGAGGAGAGGAGG + Intronic
1019398440 7:836236-836258 CAGAGAGAGAGGAGGGAAGGAGG + Intronic
1019495469 7:1337718-1337740 AAGAAGGAAAGGAGGGAGGGAGG - Intergenic
1019539330 7:1544711-1544733 CTGAGGGTCAGGAGGCAGGGAGG + Exonic
1019660156 7:2219652-2219674 CAGATGGCAAGGGGGCAAGGGGG + Intronic
1019930534 7:4220076-4220098 CAGAAGCAAAGGAAACAAGGGGG - Intronic
1020164342 7:5796414-5796436 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1021196010 7:17674955-17674977 AAGAAGCACAGGAGACAAGAAGG - Intergenic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1021971057 7:25966583-25966605 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1022042632 7:26595024-26595046 GGGAGGGTCAGGAGGCAAGGGGG - Intergenic
1022278736 7:28883318-28883340 AAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1022304903 7:29138020-29138042 CAGAAAGACAGCAGGCAGGAAGG + Intronic
1022340728 7:29465052-29465074 CAGAAGGAAAAAAGGCAAGAAGG - Intronic
1022636600 7:32142181-32142203 CAGAAGGAGAAGGGGGAAGGAGG + Intronic
1022765862 7:33410609-33410631 AAGAAGGACAGCAGGAAAGTTGG - Intronic
1023057833 7:36303964-36303986 CACAAGGACAGGAGGCCACTGGG + Intergenic
1023634981 7:42200516-42200538 TTGAAGGACACCAGGCAAGGAGG + Intronic
1023918015 7:44605088-44605110 GAGAAGGACAGGAGGAGAAGGGG + Intergenic
1024030158 7:45454147-45454169 CAGCAGGACAGCTGGCAATGGGG - Intergenic
1024604396 7:51012427-51012449 CAGAAGGGAAGAAGGGAAGGTGG + Intergenic
1024706535 7:51967221-51967243 CAGTAGGACAGGAAGGACGGGGG + Intergenic
1025167968 7:56729808-56729830 CAGGAGTTTAGGAGGCAAGGTGG + Intergenic
1025837899 7:65112896-65112918 GAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1025879370 7:65520187-65520209 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1025885169 7:65583088-65583110 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1025965387 7:66265218-66265240 CAGAAGGAGAGGAGAGATGGTGG + Intronic
1025999419 7:66549600-66549622 TAGAAGGACAAGAGGCAGGCTGG + Intergenic
1026007419 7:66610999-66611021 AGGAAGGAAAGGAGGGAAGGAGG + Intergenic
1026114106 7:67481742-67481764 CAGAAAGAAGGTAGGCAAGGAGG - Intergenic
1026252183 7:68680484-68680506 AGGAAGGAAAGGAGGCAGGGAGG + Intergenic
1026526343 7:71156645-71156667 AAGAAGGAAGGGAGGCAGGGAGG - Intronic
1026578522 7:71594654-71594676 CAGAAGGGGAGGAGGCAGGCAGG + Intronic
1026630008 7:72029914-72029936 CAGAAGCACAGGTGGCCACGTGG + Intronic
1026927423 7:74204121-74204143 GGGAAGGAGAGGAGGGAAGGAGG + Intronic
1026962841 7:74420085-74420107 CAGAAAGGAAGGAGGCAGGGAGG - Intergenic
1026968494 7:74454435-74454457 CAGAAGAGCCGGTGGCAAGGAGG - Intronic
1027450566 7:78326626-78326648 CAGAACGACAGAAGGGGAGGTGG + Intronic
1027640380 7:80725976-80725998 CAGAAGGAAAAGAGGAAAAGAGG - Intergenic
1027712250 7:81619411-81619433 TAGCAGAACATGAGGCAAGGTGG + Intergenic
1028270927 7:88788180-88788202 CATGAGGACTGGAGGCCAGGTGG + Intronic
1028957935 7:96714465-96714487 CGGAAGTGCAGAAGGCAAGGAGG + Intergenic
1029127171 7:98302568-98302590 CAGAAATACAGGAGACACGGGGG + Intronic
1029280943 7:99435134-99435156 CAGGTGGGCAGGAGGCAGGGAGG - Exonic
1029493012 7:100882428-100882450 CAGCAGGACAGGAGACAGGGCGG - Intronic
1029525229 7:101089778-101089800 CAGAAGCAGAGGAGGCAGGTGGG + Exonic
1029793703 7:102871915-102871937 GAGAAGGACTGGGGGCAGGGAGG - Intronic
1029799840 7:102934876-102934898 GACAATGACAGGAGGGAAGGAGG + Intronic
1030386653 7:108874973-108874995 CAGGAGGGGAGGGGGCAAGGAGG - Intergenic
1030424441 7:109356285-109356307 CAGAAAGAAAGGAGGGAAGGAGG + Intergenic
1030796809 7:113798793-113798815 AAGGAGAACAGGAGGGAAGGAGG + Intergenic
1031093330 7:117389323-117389345 CCAAAGGGGAGGAGGCAAGGAGG - Intronic
1031505613 7:122578399-122578421 AAGAATGACAGTAGGCAAGGAGG + Intronic
1031566230 7:123300099-123300121 AGGAAGGAAAGGAGGAAAGGAGG + Intergenic
1031856125 7:126924622-126924644 CAGAAGGAAGGGAGGAAAGAAGG - Intronic
1032034039 7:128508515-128508537 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
1032449556 7:132018121-132018143 CAGAAGTAAAGGAGGGAGGGAGG - Intergenic
1032456880 7:132079891-132079913 CAGAGGGACAGGAGGAGGGGAGG - Intergenic
1032897421 7:136266636-136266658 CAAAATGAGAGGAGACAAGGAGG + Intergenic
1033041994 7:137927376-137927398 GAGAAGGAAGGGAGGGAAGGAGG + Intronic
1033098234 7:138449244-138449266 AAGCAAGACAGGAAGCAAGGGGG - Intergenic
1033137064 7:138794341-138794363 GAGATGGACAGGTGGCAACGGGG + Intronic
1033629040 7:143139296-143139318 CAGAAGGACAGAAGGGAGGGAGG + Intronic
1033905483 7:146196542-146196564 CAGAGGGAAAGGAGGGAGGGAGG + Intronic
1034060731 7:148085724-148085746 CAGACTGACAGGAAGGAAGGAGG - Intronic
1034380277 7:150686329-150686351 GAGGAGGGAAGGAGGCAAGGTGG + Intronic
1034438994 7:151077083-151077105 CAGAGGTAAAGGAGGCAGGGTGG - Exonic
1034959825 7:155358305-155358327 CACGAGGAAAGGAGGGAAGGTGG + Exonic
1035081320 7:156219012-156219034 CAGATGGACAGCTGTCAAGGGGG + Intergenic
1035250757 7:157595525-157595547 CAGAAGGTTAGGAAGCCAGGAGG + Intronic
1035481986 7:159194299-159194321 CAGAAGGCCAGGAGCCCAGAAGG + Intergenic
1035483622 7:159205630-159205652 CAGAAGGAAAGGAGCCCAGCGGG + Intergenic
1035654061 8:1292290-1292312 TGGAAGGACAGGAGGAGAGGTGG + Intergenic
1035689886 8:1553189-1553211 CCTGAGGACAGGAGGGAAGGAGG - Intronic
1036027616 8:4927790-4927812 GAGAAGGAGAGGAGCCAAGTTGG - Intronic
1036156563 8:6347548-6347570 CAGGAGGACAGGAGAGATGGAGG - Intergenic
1036754626 8:11464134-11464156 CAGAAGGAAAGGGGGTGAGGTGG + Intronic
1037139962 8:15507870-15507892 CAGATGGAAAGGAGTGAAGGTGG + Intronic
1037216323 8:16456659-16456681 AAGGAGGAAAGGAGGAAAGGAGG + Intronic
1037247758 8:16856195-16856217 AAGAAGAACAGCAGGCAAGAAGG + Intergenic
1037684774 8:21129492-21129514 CAGAAGGACAGTGGGCCCGGAGG + Intergenic
1037774381 8:21823303-21823325 GAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1038292775 8:26264778-26264800 AAGAAGGAAAGAAGGCAGGGAGG + Intergenic
1038632762 8:29262454-29262476 AAGAAGGGCAGGGGGCCAGGCGG - Intronic
1038806345 8:30795958-30795980 CAGAAAGAAAGGAAGGAAGGAGG + Intronic
1039314539 8:36356742-36356764 AAGAAGGGAAGGAGGCAGGGAGG + Intergenic
1039471122 8:37814441-37814463 CAGAAGGTCTGGAGGCAGGCGGG - Intronic
1040491711 8:47929349-47929371 CAGAACAAGAGGAGGGAAGGTGG + Intronic
1040877480 8:52168195-52168217 CAGGAGGACAGGAGGCTATCGGG + Intronic
1041097158 8:54361539-54361561 AAGAAGGAAAGGAGGAAGGGAGG - Intergenic
1041332474 8:56741592-56741614 CAGAAAAAGAAGAGGCAAGGAGG + Intergenic
1041802325 8:61813512-61813534 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1042673432 8:71289103-71289125 AAGGAGGACAAGATGCAAGGAGG + Intronic
1042893349 8:73637191-73637213 CAGAAGGAGAGGAGGAAAAGGGG + Intronic
1042953904 8:74228175-74228197 CAGACTGGCAGGAAGCAAGGGGG - Intergenic
1043542709 8:81280976-81280998 CTAAAGGACAGGAAGCAATGCGG - Intronic
1043776290 8:84273542-84273564 CACAAGGACATGATACAAGGAGG + Intronic
1043927120 8:86049860-86049882 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1044758106 8:95488311-95488333 AAGAATGGCAGAAGGCAAGGAGG - Intergenic
1045325142 8:101112362-101112384 CAGCAGGAGCGGAGGCCAGGAGG + Intergenic
1045523272 8:102921569-102921591 AAGAAGGGAAGGAGGGAAGGAGG - Intronic
1045789379 8:105964116-105964138 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1046360849 8:113153173-113153195 AAGAAGGAAGGGAGGGAAGGAGG + Intronic
1047278344 8:123423248-123423270 CAGAAAGAAAGGAGGGAAGGAGG - Intronic
1047784064 8:128136474-128136496 CAGAAACACAGAAGTCAAGGGGG - Intergenic
1047800045 8:128299648-128299670 GAGAAGGGCAGGAGGGTAGGGGG - Intergenic
1047907001 8:129483131-129483153 AAGGAGGAGAGGAGGGAAGGGGG + Intergenic
1048292822 8:133193386-133193408 CAGAAGGAGATCAGCCAAGGAGG + Intronic
1048971664 8:139648509-139648531 CAGAGGGACAGGAGGCAGGCTGG - Intronic
1049626817 8:143627190-143627212 CAGATGAACAGGAGAAAAGGTGG + Intergenic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1051326508 9:15977028-15977050 CAGGAGGACTGGAGGAATGGAGG - Intronic
1051543462 9:18247764-18247786 AAGAAGGAAAGGAGGGAGGGAGG + Intergenic
1051803968 9:20970294-20970316 CAGAAGGATAGGAGAGAAAGGGG - Intronic
1052645742 9:31231036-31231058 CAGAAGGTCAGGACACAAGGTGG - Intergenic
1052678921 9:31663257-31663279 GGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1052795809 9:32922287-32922309 CTGAAGGGCAGGAGGAAATGGGG + Intergenic
1052861325 9:33439654-33439676 CAGAAGGACATGGGGCATGCTGG + Intergenic
1053416386 9:37949471-37949493 CAGACCTGCAGGAGGCAAGGAGG + Intronic
1053479636 9:38406434-38406456 AGGAAGGACAGGAGGCATGAGGG + Intergenic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1054929379 9:70620025-70620047 CAGGGGGAGAGGAGGAAAGGTGG - Intronic
1055224453 9:73977447-73977469 CAGAAGAACGGGAGGAAGGGAGG + Intergenic
1055822067 9:80277880-80277902 TAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056189508 9:84171023-84171045 CAGACCAACAGGAGGCAGGGAGG + Intergenic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056736540 9:89214789-89214811 CAGGTGACCAGGAGGCAAGGAGG + Intergenic
1056796474 9:89662245-89662267 CAGGAGGGCAGGAGGCGAGGGGG - Intergenic
1056839087 9:89983346-89983368 CAGAAGGAAAGGAGACCATGAGG + Intergenic
1056965166 9:91159365-91159387 AAGAAAGAGAGGAGGGAAGGAGG + Intergenic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1058179686 9:101781509-101781531 CAGAAGTACAGGAAGAAAGTAGG - Intergenic
1058378205 9:104349496-104349518 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1058641347 9:107088702-107088724 CAGCAGGAGAGGAGGTATGGTGG - Intergenic
1059283753 9:113155709-113155731 GAGAAGTACAGGATGCTAGGAGG - Intronic
1059284314 9:113159765-113159787 CAGAAGTACGGGAGACAAGCTGG - Intronic
1059309908 9:113381199-113381221 AAGAAAGAAAGGAGGGAAGGAGG - Intergenic
1059955504 9:119511617-119511639 CAGCAGGAAAGGAGGCGAGAAGG - Intronic
1060331070 9:122670887-122670909 GAGAAAGAGAGGAGGAAAGGAGG + Intergenic
1060444903 9:123679077-123679099 CTGAAAGTCAGGAGGCAGGGGGG + Intronic
1060446144 9:123690043-123690065 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1060446156 9:123690075-123690097 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1060446177 9:123690131-123690153 AAGAAGGAAAGGAGGGAGGGAGG + Intronic
1060759261 9:126234452-126234474 CAGAGAGAGAGGAGGCAGGGAGG + Intergenic
1060879833 9:127110342-127110364 CGGCAAGACAGGAGGCAGGGTGG - Intronic
1060935032 9:127509787-127509809 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
1060935039 9:127509808-127509830 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
1060967699 9:127720939-127720961 AAGAAGAAGAGGAGGAAAGGAGG - Intronic
1061117795 9:128625603-128625625 CTGAAGGAGAGCAGGAAAGGGGG + Intronic
1061272387 9:129550606-129550628 CAGAAGGAAAGGGGGCGAGTAGG - Intergenic
1061416389 9:130449374-130449396 CTGATGGGCAGGAGGCATGGCGG + Intronic
1061699306 9:132403510-132403532 AAGGATGGCAGGAGGCAAGGAGG - Intronic
1061949882 9:133930281-133930303 GAGGAGGCCAGGAGGCAGGGTGG - Intronic
1062035786 9:134381993-134382015 CAGAAGGAGAGGAGGAGACGTGG - Intronic
1062051603 9:134450168-134450190 GAGATGGGCAGCAGGCAAGGAGG - Intergenic
1062327288 9:136018301-136018323 GAGGAGGGCAGGAGGCAGGGAGG + Intronic
1062328768 9:136026460-136026482 CAGAAGGAGAGGAGGAGAGGAGG + Intronic
1062340971 9:136093924-136093946 CTGGAGAACAGGAGGGAAGGAGG + Intronic
1062599766 9:137314594-137314616 CGGGGGGACAGGGGGCAAGGGGG - Intronic
1062686099 9:137814196-137814218 CAGAGGGACAGGGGGCAGGCAGG - Intronic
1185645203 X:1610815-1610837 CCGATGGACAGGAGACAGGGTGG - Intergenic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1185680136 X:1881616-1881638 AGGAAGGAAGGGAGGCAAGGAGG + Intergenic
1185815289 X:3149344-3149366 CAGAAGGGCAGGAGGCTGAGGGG + Intergenic
1185882674 X:3755396-3755418 AAGAAGGAAGGGAGGGAAGGGGG - Intergenic
1186490708 X:9970183-9970205 AAGGAGGAAAGGAGGAAAGGAGG - Intergenic
1186490710 X:9970191-9970213 GAGAATGAAAGGAGGAAAGGAGG - Intergenic
1187066908 X:15849854-15849876 GTGAAGGACAGGAGACGAGGTGG - Intronic
1187270331 X:17774963-17774985 CAGAAAGACAGAAGAGAAGGGGG - Intergenic
1187586945 X:20673755-20673777 CAGTAGCTCAGGAAGCAAGGTGG + Intergenic
1187704301 X:21993994-21994016 GAGAAGGAAAGGAAGGAAGGGGG - Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1188114557 X:26227035-26227057 GAGAAGGAAAGGAAGGAAGGAGG - Intergenic
1188439707 X:30203556-30203578 AAGAAGGAAGGGAGGCAAGAAGG + Intergenic
1188676731 X:32950740-32950762 CAGAAGGACCGGAGACAGGTAGG + Intronic
1188802222 X:34546605-34546627 CAGAAGGAAAAGAGAGAAGGGGG + Intergenic
1189364812 X:40380313-40380335 CAGCTGGAGGGGAGGCAAGGTGG + Intergenic
1190639969 X:52474902-52474924 CAGAAGGACATGGGGGAAGAAGG + Intergenic
1190647703 X:52537963-52537985 CAGAAGGACATGGGGGAAGAAGG - Intergenic
1191904904 X:66077254-66077276 GAGAAGGAGAGAAGGGAAGGAGG - Intergenic
1192183150 X:68928921-68928943 CAGGAAGGCAGGAGGAAAGGAGG + Intergenic
1192190063 X:68985574-68985596 GAGAAGGACAGGGGGGAAGGGGG + Intergenic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1193948405 X:87766299-87766321 AAGAAGGAAAGGAGGAAAGAAGG - Intergenic
1193948406 X:87766307-87766329 AAGAAGGAAAGAAGGAAAGGAGG - Intergenic
1194000068 X:88417262-88417284 CAGAAGGAAAGAAAGGAAGGAGG + Intergenic
1194971296 X:100347199-100347221 CAGAAAGCCAGAGGGCAAGGGGG - Intronic
1194982560 X:100455047-100455069 AAGGAGGAAAGGAGGGAAGGAGG + Intergenic
1195042351 X:101026019-101026041 GAGAAGGACAGAAGGGAGGGAGG + Intronic
1195505629 X:105653514-105653536 AGGAAGGAAAGGAGGGAAGGAGG - Intronic
1195571400 X:106401906-106401928 CAGAAGGACAGAGGGCATGGAGG + Intergenic
1195908054 X:109864849-109864871 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1196149348 X:112355336-112355358 CAAAAGGAAAGGAGGGAAGAAGG + Intergenic
1196534318 X:116824224-116824246 GGAAAGGATAGGAGGCAAGGAGG + Intergenic
1196831477 X:119779109-119779131 AGGAAGGAAAGGAGGCAGGGAGG + Intergenic
1196986980 X:121284607-121284629 AGGAAGGAAAGGAGGGAAGGAGG - Intergenic
1197854412 X:130899860-130899882 ATAAAGGACAAGAGGCAAGGGGG + Intronic
1197870473 X:131058541-131058563 CAGCAGGAAGGGAGGCAAGGGGG - Intronic
1198160558 X:134003695-134003717 CAGAAGGAAGGGAGGAAGGGAGG + Intergenic
1198309464 X:135416059-135416081 CATAAGGGCAGGAGGAAACGGGG + Intergenic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1199757220 X:150875849-150875871 CATCAGGGCAGAAGGCAAGGAGG - Intronic
1199785609 X:151102409-151102431 CAGAAGGCAAAGAGGCATGGGGG + Intergenic
1199851099 X:151725373-151725395 CAGAGTGCCAGGAGGCAAGTTGG + Intergenic
1200053592 X:153447082-153447104 CACAAGGCAAGGAGGCCAGGAGG - Intronic
1200156861 X:153981388-153981410 CACCAGGCCGGGAGGCAAGGGGG - Intronic
1200540854 Y:4453976-4453998 CAGAAGGCAAGGAGGCAAGGAGG - Intergenic
1200782322 Y:7227918-7227940 AAGAAGGAAGGGAGGGAAGGGGG + Intergenic
1200854564 Y:7923587-7923609 CATAAGGACAGGACACAAGCAGG + Intergenic
1201349663 Y:13025825-13025847 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic